WormBase Tree Display for Variation: WBVar00241044

WBVar00241044 Evidence: Paper_evidence: WBPaper00001824
  Name: Public_name: q244
    Other_name: C15F1.3a.1:c.*89_*120del
    HGVSg: CHROMOSOME_II:g.6955499_6955530del
  Sequence_details: SMap: S_parent: Sequence: F22D3
    Flanking_sequences: TTTCTATTATTTGTACAATTTCCATTTCAT TATTTAATTTCTTATCTACTCATATCTAAT
    Mapping_target: F22D3
    Type_of_mutation: Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: JK
    Status: Live
  Affects: Gene: WBGene00006605
    Transcript: C15F1.3a.1 VEP_consequence: 3_prime_UTR_variant
        VEP_impact: MODIFIER
        HGVSc: C15F1.3a.1:c.*89_*120del
        cDNA_position: 4517-4548
        Exon_number: 24/24
  Genetics: Interpolated_map_position: II 0.150004
  Reference: WBPaper00001824
  Remark: e2046, q122, and q244 all carry the same molecular change but were produced by different labs independently. WormBase has a policy to merge identical naturally occurring polymorphisms in wild isolates, but maintain separate records for mutants.
  Method: Deletion_allele