WormBase Tree Display for Variation: WBVar00241025
expand all nodes | collapse all nodes | view schema
WBVar00241025 | Evidence | Paper_evidence | WBPaper00001553 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | q179 | |||||
Other_name | CE43762:p.Arg312Gln | ||||||
C15F1.3c.1:c.935G>A | |||||||
CE23546:p.Arg1400Gln | |||||||
C15F1.3a.1:c.4199G>A | |||||||
HGVSg | CHROMOSOME_II:g.6955848C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | C15F1 | |||
Flanking_sequences | aatattgcgaagatatttactggacacacc | aactggacagctacctccaggacttcaagt | |||||
Mapping_target | C15F1 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001553 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | JK | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006605 | |||||
Transcript | C15F1.3a.1 (12) | ||||||
C15F1.3c.1 (12) | |||||||
Genetics | Interpolated_map_position | II | 0.150415 | ||||
Description | Phenotype | WBPhenotype:0001022 | Paper_evidence | WBPaper00001037 | |||
Curator_confirmed | WBPerson2021 | ||||||
Remark | XX animals show semidominant germ-line feminization and recessive somatic masculinization (truncated tail and Egl). | Paper_evidence | WBPaper00001037 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00001037 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Reference | WBPaper00001553 | ||||||
WBPaper00001037 | |||||||
Method | Substitution_allele |