WormBase Tree Display for Variation: WBVar00241014
expand all nodes | collapse all nodes | view schema
WBVar00241014 | Evidence | Paper_evidence | WBPaper00001824 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | q122 | |||||
Other_name | C15F1.3a.1:c.*89_*120del | ||||||
HGVSg | CHROMOSOME_II:g.6955499_6955530del | ||||||
Sequence_details | SMap | S_parent | Sequence | F22D3 | |||
Flanking_sequences | TTTCTATTATTTGTACAATTTCCATTTCAT | TATTTAATTTCTTATCTACTCATATCTAAT | |||||
Mapping_target | F22D3 | ||||||
Type_of_mutation | Deletion | ||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin (4) | |||||||
Affects | Gene | WBGene00006605 | |||||
Transcript | C15F1.3a.1 | VEP_consequence | 3_prime_UTR_variant | ||||
VEP_impact | MODIFIER | ||||||
HGVSc | C15F1.3a.1:c.*89_*120del | ||||||
cDNA_position | 4517-4548 | ||||||
Exon_number | 24/24 | ||||||
Genetics | Interpolated_map_position | II | 0.150004 | ||||
Description | Phenotype | WBPhenotype:0000682 | Paper_evidence | WBPaper00001037 | |||
Curator_confirmed | WBPerson2021 | ||||||
Remark | XX animals are female in the germ line. ql22gf X0 animals are generally unaffected, although old males show some oogenesis and yolk synthesis. | Paper_evidence | WBPaper00001037 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00001037 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Reference | WBPaper00001037 | ||||||
WBPaper00001824 | |||||||
Remark | e2046, q122, and q244 all carry the same molecular change but were produced by different labs independently. WormBase has a policy to merge identical naturally occurring polymorphisms in wild isolates, but maintain separate records for mutants. | ||||||
Method | Deletion_allele |