WormBase Tree Display for Variation: WBVar00240993
expand all nodes | collapse all nodes | view schema
WBVar00240993 | Evidence | Paper_evidence | WBPaper00001677 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | q50 | |||||||
Other_name | CE00237:p.Cys126Ser | ||||||||
F02A9.6.1:c.376T>A | |||||||||
HGVSg | CHROMOSOME_III:g.9094707T>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F02A9 | |||||
Flanking_sequences | tcgggagtaaatccatgcgattcggatcct | gcaacaacggactctgctatccattctatg | |||||||
Mapping_target | F02A9 | ||||||||
Type_of_mutation | Substitution | t | a | Paper_evidence | WBPaper00001677 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | JK | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001609 | |||||||
Transcript | F02A9.6.1 (12) | ||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | III | 0.162787 | ||||||
Description | Phenotype | WBPhenotype:0000286 | Paper_evidence | WBPaper00001007 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Although signs of pharyngeal differentiation is seen within the embryo, morphogenesis is defective, and a recognizable worm is not made. | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001007 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001007 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000684 | Paper_evidence | WBPaper00001007 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Only 6-21 germ cells are produced in glp-1 mutants. All these germ cells differentiate into sperm | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 84 | 84 | Paper_evidence | WBPaper00001007 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00001007 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001007 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000823 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | weaker phenotype than q46, some oocyte production, fertilized eggs arrest during embryogenesis) | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000867 | Paper_evidence | WBPaper00001007 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | fertilized eggs arrest during embryogenesis | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00001007 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00001007 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | Strictly_maternal | Paper_evidence | WBPaper00001007 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00001007 | ||||||||
Method | Substitution_allele |