WormBase Tree Display for Variation: WBVar00240984
expand all nodes | collapse all nodes | view schema
| WBVar00240984 | Evidence | Paper_evidence | WBPaper00026963 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | q12 | |||||||
| Other_name | F44C4.4b.1:c.1793G>A | ||||||||
| CE38823:p.Trp598Ter | |||||||||
| CE38824:p.Trp598Ter | |||||||||
| F44C4.4a.1:c.1793G>A | |||||||||
| HGVSg | CHROMOSOME_V:g.6608911C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F44C4 | |||||
| Flanking_sequences | atggctctgatctccttgcatcagccgact | gatgaaaatcaaaactgatttatccagtca | |||||||
| Mapping_target | F44C4 | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00026963 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00022598 | ||||||||
| Laboratory | JK | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00002148 | |||||||
| Transcript | F44C4.4b.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F44C4.4b.1:c.1793G>A | ||||||||
| HGVSp | CE38824:p.Trp598Ter | ||||||||
| cDNA_position | 1793 | ||||||||
| CDS_position | 1793 | ||||||||
| Protein_position | 598 | ||||||||
| Exon_number | 9/15 | ||||||||
| Codon_change | tGg/tAg | ||||||||
| Amino_acid_change | W/* | ||||||||
| F44C4.4a.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F44C4.4a.1:c.1793G>A | ||||||||
| HGVSp | CE38823:p.Trp598Ter | ||||||||
| cDNA_position | 1793 | ||||||||
| CDS_position | 1793 | ||||||||
| Protein_position | 598 | ||||||||
| Exon_number | 9/15 | ||||||||
| Codon_change | tGg/tAg | ||||||||
| Amino_acid_change | W/* | ||||||||
| Interactor | WBInteraction000502264 | ||||||||
| WBInteraction000502265 | |||||||||
| Genetics | Interpolated_map_position | V | 0.111025 | ||||||
| Description | Phenotype | WBPhenotype:0000059 | Paper_evidence | WBPaper00006440 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "For gon-14, most animals homozygous for the strong loss-of-function allele gon-14(q12) arrested at midlarval development (L2 or L3), but animals homozygous for the temperature-sensitive allele, gon-14(q686), developed to adulthood more slowly than wild type (see materials and methods)." | Paper_evidence | WBPaper00006440 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| EQ_annotations | GO_term | GO:0002164 | PATO:0000460 | Paper_evidence | WBPaper00006440 | ||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_not_observed | WBPhenotype:0001585 | Paper_evidence | WBPaper00006440 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "In contrast to the Wnt/MAPK mutants, which eliminate POP-1 asymmetry, sys-1, sys-3, gon-14, gon-15, and gon-16 mutants did not affect POP-1 asymmetry (Figure 5)." | Paper_evidence | WBPaper00006440 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Reference | WBPaper00006440 | ||||||||
| WBPaper00026963 | |||||||||
| Method | Substitution_allele |
