WormBase Tree Display for Variation: WBVar00239316
expand all nodes | collapse all nodes | view schema
WBVar00239316 | Evidence | Paper_evidence | WBPaper00031936 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | pk480 | |||||||
Other_name | pk480df | ||||||||
F48C11.1.1:c.623+350_1001del | |||||||||
HGVSg | CHROMOSOME_X:g.13192589_13193474del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F48C11 | |||||
Flanking_sequences | gccacagtaaaatctttttattttaacatt | agcgacagatacggggaatattgatctggt | |||||||
Mapping_target | F48C11 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00007863 | ||||||||
WBStrain00028950 | |||||||||
Laboratory | NL | ||||||||
Status | Live | ||||||||
Affects (3) | |||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | X | 10.2257 | ||||||
Mapping_data | In_multi_point | 4372 | |||||||
Description | Phenotype (14) | ||||||||
Phenotype_not_observed | WBPhenotype:0001414 | Paper_evidence | WBPaper00003465 | ||||||
Curator_confirmed | WBPerson291 | ||||||||
WBPhenotype:0001434 | Paper_evidence | WBPaper00003465 | |||||||
Curator_confirmed | WBPerson291 | ||||||||
Remark | No defects when tested for response to glucose, CuSo4, 4M fructose, SDS and various volatile chemicals. | Paper_evidence | WBPaper00003465 | ||||||
Curator_confirmed | WBPerson291 | ||||||||
Affected_by | Molecule | WBMol:00005569 | Paper_evidence | WBPaper00003465 | |||||
Curator_confirmed | WBPerson291 | ||||||||
WBMol:00003937 | Paper_evidence | WBPaper00003465 | |||||||
Curator_confirmed | WBPerson291 | ||||||||
WBMol:00002899 | Paper_evidence | WBPaper00003465 | |||||||
Curator_confirmed | WBPerson291 | ||||||||
WBMol:00003977 | Paper_evidence | WBPaper00003465 | |||||||
Curator_confirmed | WBPerson291 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Animals with mutations in individual G protein subunits respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00003465 | |||||||
Curator_confirmed | WBPerson291 | ||||||||
Reference | WBPaper00043908 | ||||||||
WBPaper00031936 | |||||||||
WBPaper00003465 | |||||||||
Method | Deletion_allele |