WormBase Tree Display for Variation: WBVar00239299
expand all nodes | collapse all nodes | view schema
WBVar00239299 | Evidence | Paper_evidence | WBPaper00031936 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | pk376 | |||||||
Other_name | pk376te | ||||||||
HGVSg | CHROMOSOME_X:g.2118825_2121212del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F53B1 | |||||
Flanking_sequences | tcttcattatttttttcatagaatctgagt | aaacacccatttttgtgtttaaccatgcgg | |||||||
Mapping_target | F53B1 | ||||||||
Type_of_mutation | Insertion | ||||||||
Deletion | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Transposon_insertion | Tc1 | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00007863 | ||||||||
WBStrain00028947 | |||||||||
Laboratory | NL | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001667 | |||||||
Transcript | F53B1.7.1 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | ||||||||
Intron_number | 1-7/7 | ||||||||
Exon_number | 1-8/8 | ||||||||
Interactor | WBInteraction000502424 | ||||||||
Isolation (2) | |||||||||
Genetics | Interpolated_map_position | X | -17.0396 | ||||||
Mapping_data | In_multi_point | 4371 | |||||||
Description | Phenotype (18) | ||||||||
Phenotype_not_observed | WBPhenotype:0001414 | Paper_evidence | WBPaper00003465 | ||||||
Curator_confirmed | WBPerson291 | ||||||||
WBPhenotype:0001434 | Paper_evidence | WBPaper00003465 | |||||||
Curator_confirmed | WBPerson291 | ||||||||
Remark | No defects when tested for response to glucose, CuSo4, 4M fructose, SDS and various volatile chemicals. | Paper_evidence | WBPaper00003465 | ||||||
Curator_confirmed | WBPerson291 | ||||||||
Affected_by | Molecule | WBMol:00005569 | Paper_evidence | WBPaper00003465 | |||||
Curator_confirmed | WBPerson291 | ||||||||
WBMol:00003937 | Paper_evidence | WBPaper00003465 | |||||||
Curator_confirmed | WBPerson291 | ||||||||
WBMol:00002899 | Paper_evidence | WBPaper00003465 | |||||||
Curator_confirmed | WBPerson291 | ||||||||
WBMol:00003977 | Paper_evidence | WBPaper00003465 | |||||||
Curator_confirmed | WBPerson291 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Animals with mutations in individual G protein subunits respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00003465 | |||||||
Curator_confirmed | WBPerson291 | ||||||||
Reference | WBPaper00043908 | ||||||||
WBPaper00031936 | |||||||||
WBPaper00003465 | |||||||||
Remark | Insertion is a tc1 element | ||||||||
Method | Transposon_insertion |