WormBase Tree Display for Variation: WBVar00239290
expand all nodes | collapse all nodes | view schema
| WBVar00239290 | Evidence | Paper_evidence | WBPaper00031936 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | pk362 | |||||||
| Other_name | pk362df | ||||||||
| HGVSg | CHROMOSOME_V:g.6852845_6855739del | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C55H1 | |||||
| Flanking_sequences | tgtgttgtcacgacttttaagcctatgtga | aacgtaattttacaggtacacccatgaaac | |||||||
| Mapping_target | C55H1 | ||||||||
| Type_of_mutation | Insertion | ||||||||
| Deletion | |||||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00028951 | ||||||||
| Laboratory | NL | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00001672 | |||||||
| Transcript | C55H1.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
| VEP_impact | HIGH | ||||||||
| Intron_number | 2-9/10 | ||||||||
| Exon_number | 1-9/11 | ||||||||
| Isolation | Mutagen | EMS | |||||||
| Genetics | Interpolated_map_position | V | 0.352717 | ||||||
| Mapping_data | In_multi_point | 4376 | |||||||
| Description | Phenotype (14) | ||||||||
| Phenotype_not_observed | WBPhenotype:0001048 | Paper_evidence | WBPaper00003465 | ||||||
| Curator_confirmed | WBPerson291 | ||||||||
| WBPhenotype:0001414 | Paper_evidence | WBPaper00003465 | |||||||
| Curator_confirmed | WBPerson291 | ||||||||
| WBPhenotype:0001434 | Paper_evidence | WBPaper00003465 | |||||||
| Curator_confirmed | WBPerson291 | ||||||||
| WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Animals with mutations in individual G protein subunits respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0002535 | Paper_evidence | WBPaper00003465 | |||||||
| Curator_confirmed | WBPerson291 | ||||||||
| Reference | WBPaper00043908 | ||||||||
| WBPaper00031936 | |||||||||
| WBPaper00003465 | |||||||||
| Remark | Insertion of 445bp unknown sequence | ||||||||
| Method | Deletion_and_insertion_allele |
