WormBase Tree Display for Variation: WBVar00239282
expand all nodes | collapse all nodes | view schema
| WBVar00239282 | Evidence | Paper_evidence | WBPaper00031936 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | pk345 | |||||||
| Other_name | pk345te | ||||||||
| HGVSg | CHROMOSOME_V:g.12639128_12641598del | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F56H9 | |||||
| Flanking_sequences | ctcatgtgcttttattttgttagcgttgta | ttaaaaaactttataactgtttcaggtcca | |||||||
| Mapping_target | F56H9 | ||||||||
| Type_of_mutation | Insertion | ||||||||
| Deletion | |||||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Transposon_insertion | Tc1 | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00028949 | ||||||||
| Laboratory | NL | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00001670 | |||||||
| Transcript | F56H9.3.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
| VEP_impact | HIGH | ||||||||
| Intron_number | 2-9/11 | ||||||||
| Exon_number | 1-9/12 | ||||||||
| Isolation | Mutagen | Tc1 | |||||||
| Reverse_genetics | Tc1-derived deletion | Paper_evidence | WBPaper00031936 | ||||||
| Genetics | Interpolated_map_position | V | 4.54382 | ||||||
| Mapping_data | In_multi_point | 4374 | |||||||
| Description | Phenotype (16) | ||||||||
| Phenotype_not_observed | WBPhenotype:0001414 | Paper_evidence | WBPaper00003465 | ||||||
| Curator_confirmed | WBPerson291 | ||||||||
| WBPhenotype:0001434 | Paper_evidence | WBPaper00003465 | |||||||
| Curator_confirmed | WBPerson291 | ||||||||
| Remark | No defects when tested for response to glucose, CuSo4, 4M fructose, SDS and various volatile chemicals. | Paper_evidence | WBPaper00003465 | ||||||
| Curator_confirmed | WBPerson291 | ||||||||
| Affected_by | Molecule | WBMol:00005569 | Paper_evidence | WBPaper00003465 | |||||
| Curator_confirmed | WBPerson291 | ||||||||
| WBMol:00003937 | Paper_evidence | WBPaper00003465 | |||||||
| Curator_confirmed | WBPerson291 | ||||||||
| WBMol:00002899 | Paper_evidence | WBPaper00003465 | |||||||
| Curator_confirmed | WBPerson291 | ||||||||
| WBMol:00003977 | Paper_evidence | WBPaper00003465 | |||||||
| Curator_confirmed | WBPerson291 | ||||||||
| WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Animals with mutations in individual G protein subunits respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0002535 | Paper_evidence | WBPaper00003465 | |||||||
| Curator_confirmed | WBPerson291 | ||||||||
| Reference | WBPaper00043908 | ||||||||
| WBPaper00031936 | |||||||||
| WBPaper00003465 | |||||||||
| WBPaper00053887 | |||||||||
| Remark | Insertion is a tc1 element | ||||||||
| Method | Transposon_insertion |
