WormBase Tree Display for Variation: WBVar00239157
expand all nodes | collapse all nodes | view schema
WBVar00239157 | Name | Public_name | pk15 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | pk15te | ||||||||
T19C4.6a.1:c.119-58_969del | |||||||||
HGVSg | CHROMOSOME_V:g.11174672_11176781del | ||||||||
Sequence_details | SMap | S_parent | Sequence | T19C4 | |||||
Flanking_sequences | tgcaccatggaaatgcgattactaatcaaa | tgtcatcacacttgtgctacagacacacaa | |||||||
Mapping_target | T19C4 | ||||||||
Type_of_mutation | Insertion | ||||||||
Deletion | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Transposon_insertion | Tc1 | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00028898 | ||||||||
Laboratory | NL | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00014521 | |||||||
WBGene00001663 | |||||||||
WBGene00045170 | |||||||||
WBGene00196066 | |||||||||
WBGene00011839 | |||||||||
WBGene00196822 | |||||||||
Transcript | T19C4.17 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | ||||||||
Exon_number | 1/1 | ||||||||
T19C4.6b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
cDNA_position | ?-813 | ||||||||
CDS_position | ?-813 | ||||||||
Protein_position | ?-271 | ||||||||
Intron_number | 1-6/6 | ||||||||
Exon_number | 1-7/7 | ||||||||
T19C4.t1 | VEP_consequence | transcript_ablation | |||||||
VEP_impact | HIGH | ||||||||
Exon_number | 1/1 | ||||||||
T19C4.12 | VEP_consequence | transcript_ablation | |||||||
VEP_impact | HIGH | ||||||||
Exon_number | 1/1 | ||||||||
T19C4.5a.1 | VEP_consequence | 3_prime_UTR_variant | |||||||
VEP_impact | MODIFIER | ||||||||
cDNA_position | 1412-? | ||||||||
Exon_number | 8/8 | ||||||||
T19C4.19 | VEP_consequence | transcript_ablation | |||||||
VEP_impact | HIGH | ||||||||
Exon_number | 1/1 | ||||||||
T19C4.6a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T19C4.6a.1:c.119-58_969del | ||||||||
cDNA_position | ?-1087 | ||||||||
CDS_position | ?-969 | ||||||||
Protein_position | ?-323 | ||||||||
Intron_number | 2-8/9 | ||||||||
Exon_number | 3-9/10 | ||||||||
T19C4.5b.1 | VEP_consequence | 3_prime_UTR_variant | |||||||
VEP_impact | MODIFIER | ||||||||
cDNA_position | 1945-? | ||||||||
Exon_number | 7/7 | ||||||||
Interactor | WBInteraction000502743 | ||||||||
Isolation | Mutagen | Tc1 | |||||||
Reverse_genetics | Tc1-derived deletion | ||||||||
Derived_from_variation | WBVar00239143 | ||||||||
Genetics | Interpolated_map_position | V | 2.96778 | ||||||
Description | Phenotype (11) | ||||||||
Phenotype_not_observed | WBPhenotype:0000677 | Paper_evidence | WBPaper00003465 | ||||||
Curator_confirmed | WBPerson291 | ||||||||
Remark | No defects when tested for response to glucose, CuSo4, 4M fructose, SDS and various volatile chemicals. | Paper_evidence | WBPaper00003465 | ||||||
Curator_confirmed | WBPerson291 | ||||||||
Affected_by | Molecule | WBMol:00005569 | Paper_evidence | WBPaper00003465 | |||||
Curator_confirmed | WBPerson291 | ||||||||
WBMol:00003937 | Paper_evidence | WBPaper00003465 | |||||||
Curator_confirmed | WBPerson291 | ||||||||
WBMol:00002899 | Paper_evidence | WBPaper00003465 | |||||||
Curator_confirmed | WBPerson291 | ||||||||
WBMol:00003977 | Paper_evidence | WBPaper00003465 | |||||||
Curator_confirmed | WBPerson291 | ||||||||
WBPhenotype:0001414 | Paper_evidence | WBPaper00003465 | |||||||
Curator_confirmed | WBPerson291 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Animals with mutations in individual G protein subunits respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002055 | Paper_evidence | WBPaper00036207 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Photocurrents appeared to be normal. | Paper_evidence | WBPaper00036207 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002212 | Paper_evidence | WBPaper00003465 | |||||||
Curator_confirmed | WBPerson291 | ||||||||
Reference | WBPaper00001784 | ||||||||
WBPaper00043908 | |||||||||
WBPaper00031936 | |||||||||
WBPaper00003465 | |||||||||
WBPaper00036207 | |||||||||
Remark | Insertion is a tc1 element | ||||||||
Method | Transposon_insertion |