WormBase Tree Display for Variation: WBVar00146627
expand all nodes | collapse all nodes | view schema
WBVar00146627 | Evidence | Paper_evidence | WBPaper00029020 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | h662 | |||||
Other_name | Y47D3B.10.1:c.265-1G>A | ||||||
HGVSg | CHROMOSOME_III:g.11376138C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | Y47D3B | |||
Flanking_sequences | ttttgtctatctcaatttctaaatggcctataaccccacaaatcttca | atctttgactggaaggagatcgagtcgaaaatga | |||||
Mapping_target | Y47D3B | ||||||
Type_of_mutation | Substitution | g | a | Person_evidence | WBPerson1589 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00003938 | ||||||
WBStrain00003943 | |||||||
WBStrain00004790 | |||||||
WBStrain00005641 | |||||||
WBStrain00005642 | |||||||
WBStrain00007127 | |||||||
WBStrain00007147 | |||||||
WBStrain00007149 | |||||||
WBStrain00007150 | |||||||
WBStrain00023901 | |||||||
Laboratory | KR | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00001077 | |||||
Transcript | Y47D3B.10.1 | VEP_consequence | splice_acceptor_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | Y47D3B.10.1:c.265-1G>A | ||||||
Intron_number | 2/8 | ||||||
Genetics | Interpolated_map_position | III | 8.86195 | ||||
Marked_rearrangement | hT2[dpy-18(h662) unc-59(e261)] | ||||||
hT2[dpy-18(h662)] | |||||||
Reference | WBPaper00029020 | ||||||
Remark | [160309 ar2] The single base mutation g->a disruptes the splice site. An alternate site is used resulting in the errant inclusion of 57bp genomic sequence which includes a stop codon. | ||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00001077 Nonsense | |||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00001077 Acceptor | |||||||
Method | Substitution_allele |