WormBase Tree Display for Variation: WBVar00146371
expand all nodes | collapse all nodes | view schema
| WBVar00146371 | Evidence | Paper_evidence | WBPaper00032941 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | gm331 | |||||
| Other_name | CE51313:p.Gln603Ter | ||||||
| K07G5.1.1:c.1807C>T | |||||||
| HGVSg | CHROMOSOME_I:g.7154359G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | K07G5 | |||
| Flanking_sequences | tttggagccagaattctttcgaaagcacta | aagttaatgtatctcttcgatctgtgtccat | |||||
| Mapping_target | K07G5 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00032941 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | NG | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00010641 | |||||
| Transcript | K07G5.1.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | K07G5.1.1:c.1807C>T | ||||||
| HGVSp | CE51313:p.Gln603Ter | ||||||
| cDNA_position | 1873 | ||||||
| CDS_position | 1807 | ||||||
| Protein_position | 603 | ||||||
| Exon_number | 10/12 | ||||||
| Codon_change | Caa/Taa | ||||||
| Amino_acid_change | Q/* | ||||||
| Isolation | Mutagen | EMS | |||||
| Genetics | Interpolated_map_position | I | 1.80431 | ||||
| Description | Phenotype_not_observed | WBPhenotype:0000886 | Paper_evidence | WBPaper00032941 | |||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | crml-1 mutants had no obvious abnormal phenotype in the absence of an unc-34 mutation | Paper_evidence | WBPaper00032941 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Reference | WBPaper00032941 | ||||||
| Method | Substitution_allele |
