WormBase Tree Display for Variation: WBVar00146356
expand all nodes | collapse all nodes | view schema
| WBVar00146356 | Evidence | Paper_evidence | WBPaper00002850 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | gm144 | |||||
| Other_name | CE00205:p.Pro1072Leu | ||||||
| F54G8.3.1:c.3215C>T | |||||||
| HGVSg | CHROMOSOME_III:g.9168714G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | F54G8 | |||
| Flanking_sequences | atgcagctttcgttgaaacatctgctgatc | tgataggcctacaattggtgggttttttga | |||||
| Mapping_target | F54G8 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002850 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00028742 | ||||||
| Laboratory | NG | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00002081 | |||||
| Transcript | F54G8.3.1 (12) | ||||||
| Interactor | WBInteraction000503959 | ||||||
| Genetics | Interpolated_map_position | III | 0.270678 | ||||
| Description | Phenotype (12) | ||||||
| Phenotype_not_observed | WBPhenotype:0000104 | Paper_evidence | WBPaper00035117 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | The polarity of the invasive membrane components was normal in ina-1(gm144) mutants | Paper_evidence | WBPaper00035117 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00035117 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| WBPhenotype:0000163 | Paper_evidence | WBPaper00002978 | |||||
| Curator_confirmed | WBPerson557 | ||||||
| WBPhenotype:0000241 | Paper_evidence | WBPaper00004897 | |||||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | No accumulation of dead cell corpses | Paper_evidence | WBPaper00004897 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| WBPhenotype:0000700 | Paper_evidence | WBPaper00002978 | |||||
| Curator_confirmed | WBPerson557 | ||||||
| WBPhenotype:0001652 | Paper_evidence | WBPaper00035117 | |||||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | ina-1(gm144) animals had normal AC invasion | Paper_evidence | WBPaper00035117 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00035117 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Disease_info | Models_disease | DOID:1826 | |||||
| Models_disease_in_annotation | WBDOannot00000556 | ||||||
| Reference | WBPaper00002978 | ||||||
| WBPaper00004897 | |||||||
| WBPaper00035198 | |||||||
| WBPaper00032026 | |||||||
| WBPaper00035117 | |||||||
| WBPaper00006471 | |||||||
| Method | Substitution_allele |
