WormBase Tree Display for Variation: WBVar00146321
expand all nodes | collapse all nodes | view schema
WBVar00146321 | Evidence | Paper_evidence | WBPaper00031121 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | gm41 | |||||||
Other_name | F44A6.2.1:c.856-1G>A | ||||||||
HGVSg | CHROMOSOME_X:g.10202476C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F44A6 | |||||
Flanking_sequences | taaaatcatactaaacgttaaaatgtttca | agaatcaatgaagactcaaaaatgaatcga | |||||||
Mapping_target | F44A6 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00031121 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00028733 | ||||||||
Laboratory | NG | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004786 | |||||||
Transcript | F44A6.2.1 | VEP_consequence | splice_acceptor_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F44A6.2.1:c.856-1G>A | ||||||||
Intron_number | 5/8 | ||||||||
Interactor | WBInteraction000052217 | ||||||||
Genetics | Interpolated_map_position | X | 1.88075 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00003262 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | XX survivors of lethality are Egl. | Paper_evidence | WBPaper00003262 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00003262 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000050 | Paper_evidence | WBPaper00035459 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Inactivation of sex-1 causes greater than 30% embryonic lethality | Paper_evidence | WBPaper00035459 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000065 | Paper_evidence | WBPaper00003262 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | XO viability of sex-1(gm41) homozygotes alone is weakly reduced to 89%; however, gm41 suppresses the XO lethality caused by the presence of 3 copies of sex-1(+). | Paper_evidence | WBPaper00003262 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00003262 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00003262 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Assay for suppression of extra copies of sex-1(+) occurred in the following background: stDp2/stDp2;him-5;unc-115 sex-1(gm41). | Paper_evidence | WBPaper00003262 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | unc-1 or unc-2 | Paper_evidence | WBPaper00003262 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000066 | Paper_evidence | WBPaper00003262 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 37% viability (233 live adults/ 627 total embryos laid) from a homozygous sex-1 mother. Viability is increased to 90% when derived from a sex-1/+ mother (measured in an unc-58/+ background). | Paper_evidence | WBPaper00003262 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00003262 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00003262 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | With_maternal_effect | Paper_evidence | WBPaper00003262 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000425 | Paper_evidence | WBPaper00003262 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No staining was detected. Anti-SEX-1 was generated against a His6-tagged fragment of SEX-1 aa 1-152 . | Paper_evidence | WBPaper00003262 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00003262 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00003262 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | XX survivors of lethality are Dpy. | Paper_evidence | WBPaper00003262 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00003262 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000867 | Paper_evidence | WBPaper00035459 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | A significant proportion of sex-1 mutant embryos was arrested in development | Paper_evidence | WBPaper00035459 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00003262 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | yIs33[Pxol-1::lacZ] expression is observed in XX embryos, whereas expression is normally only observed in XO embryos. | Paper_evidence | WBPaper00003262 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00003262 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00003262 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | yIs33[Pxol-1::lacZ]; him-5 | Paper_evidence | WBPaper00003262 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001276 | Paper_evidence | WBPaper00035459 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | xol-1::gfp was ectopically expressed in sex-1(gm41) mutant XX embryos | Paper_evidence | WBPaper00035459 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | yIs34 [xol-1::gfp] | Paper_evidence | WBPaper00035459 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00015288 | ||||||||
WBPaper00017234 | |||||||||
WBPaper00035459 | |||||||||
WBPaper00003262 | |||||||||
WBPaper00018396 | |||||||||
Method | Substitution_allele |