WormBase Tree Display for Variation: WBVar00146316
expand all nodes | collapse all nodes | view schema
WBVar00146316 | Evidence | Paper_evidence | WBPaper00003027 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | gm33 | |||||||
Other_name | F55C7.7a.1:c.1006-6A>G | ||||||||
F55C7.7i.2:c.1006-6A>G | |||||||||
F55C7.7i.1:c.1006-6A>G | |||||||||
F55C7.7b.1:c.1006-6A>G | |||||||||
HGVSg | CHROMOSOME_I:g.4026947T>C | ||||||||
Sequence_details | SMap | S_parent | Sequence | C09D1 | |||||
Flanking_sequences | gtgatgtatagacaatttctggttttttta | aacagggtatggaagtgtctgtgaaacaag | |||||||
Mapping_target | C09D1 | ||||||||
Type_of_mutation | Substitution | a | g | Paper_evidence | WBPaper00003027 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00028731 | ||||||||
Laboratory | NG | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006805 | |||||||
Transcript | F55C7.7i.1 | VEP_consequence | splice_region_variant,intron_variant | ||||||
VEP_impact | LOW | ||||||||
HGVSc | F55C7.7i.1:c.1006-6A>G | ||||||||
Intron_number | 6/25 | ||||||||
F55C7.7b.1 | VEP_consequence | splice_region_variant,intron_variant | |||||||
VEP_impact | LOW | ||||||||
HGVSc | F55C7.7b.1:c.1006-6A>G | ||||||||
Intron_number | 6/20 | ||||||||
F55C7.7a.1 | VEP_consequence | splice_region_variant,intron_variant | |||||||
VEP_impact | LOW | ||||||||
HGVSc | F55C7.7a.1:c.1006-6A>G | ||||||||
Intron_number | 7/33 | ||||||||
F55C7.7i.2 | VEP_consequence | splice_region_variant,intron_variant | |||||||
VEP_impact | LOW | ||||||||
HGVSc | F55C7.7i.2:c.1006-6A>G | ||||||||
Intron_number | 6/24 | ||||||||
Interactor | WBInteraction000538757 | ||||||||
WBInteraction000538762 | |||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | I | -1.84382 | ||||||
Description | Phenotype | WBPhenotype:0000104 | Paper_evidence | WBPaper00004437 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Mutations in unc-73 also blocked the Q migrations and disrupted the polarized leading processes (Fig. 3I-M). In animals carrying the weak unc-73 allele e936, 6% of the QL cells were unpolarized and 9% of the QR cells were unpolarized. In animals containing the stronger unc-73 allele, gm33, 24% of QL cells and 26% of QR cells were unpolarized." | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004056 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004054 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0030010 | PATO:0000460 | Paper_evidence | WBPaper00004437 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000425 | Paper_evidence | WBPaper00004437 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Mutant animals exhibited reduced or lost expression of MAB-5 protein in QL descendants, as determined by antibody staining (Figure 6E) | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007274 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0007276 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001404 | Paper_evidence | WBPaper00004437 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Mutant animals exhibited ectopic expression of MAB-5 protein in QR descendants, as determined by antibody staining (Figure 6E) | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007279 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0007281 | PATO:0000460 | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00003027 | ||||||||
WBPaper00004437 | |||||||||
Method | Substitution_allele |