WormBase Tree Display for Variation: WBVar00145978
expand all nodes | collapse all nodes | view schema
| WBVar00145978 | Evidence | Paper_evidence | WBPaper00038487 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | gk646 | |||||
| Other_name | C34D1.5b.1:c.289-1393_447+206del | ||||||
| HGVSg | CHROMOSOME_V:g.13267427_13269434del | ||||||
| Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_V | |||
| Flanking_sequences | acgatgttacagcttttcttatctttgttt | agttaacaaacatgaaacacgaccgaattt | |||||
| Mapping_target | CHROMOSOME_V | ||||||
| Type_of_mutation | Deletion | ||||||
| PCR_product | gk646_external | ||||||
| gk646_internal | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00036563 | ||||||
| Laboratory | VC | ||||||
| Person | WBPerson427 | ||||||
| KO_consortium_allele | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00007932 | |||||
| Transcript | C34D1.5a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||
| VEP_impact | HIGH | ||||||
| Intron_number | 1-3/4 | ||||||
| Exon_number | 1-3/5 | ||||||
| C34D1.5b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | C34D1.5b.1:c.289-1393_447+206del | ||||||
| Intron_number | 2-4/5 | ||||||
| Exon_number | 3-4/6 | ||||||
| C34D1.5c.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
| VEP_impact | HIGH | ||||||
| Intron_number | 1/1 | ||||||
| Exon_number | 1/2 | ||||||
| Isolation | Mutagen | UV/TMP | |||||
| Description | Phenotype | WBPhenotype:0004027 | Paper_evidence | WBPaper00038487 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Animals exhibit a lower probability of escape responses (reversal) compared to N2 animals upon an initial plate tap. | Paper_evidence | WBPaper00038487 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Phenotype_not_observed | WBPhenotype:0002469 | Paper_evidence | WBPaper00038487 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | The probability and size of response to plate taps decreased with continued taps applied with a 10s interval, similar to the response of N2 animals. | Paper_evidence | WBPaper00038487 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00038487 | ||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
| Method | KO_consortium_allele |
