WormBase Tree Display for Variation: WBVar00145922
expand all nodes | collapse all nodes | view schema
WBVar00145922 | Evidence | Paper_evidence | WBPaper00038522 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | gk554 | |||||||
Other_name | Y73B6BL.21a.1:c.153+60_437del | ||||||||
HGVSg | CHROMOSOME_IV:g.6400955_6402215del | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y73B6BL | |||||
Flanking_sequences | ttagcgggctgcattggttttatacacata | atcttcataaattttcacaatttatgcaca | |||||||
Mapping_target | Y73B6BL | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | gk554_external | ||||||||
gk554_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Deletion_verification | PCR with one primer internal to the deletion and one external confirms that no WT copy of the gene remains. | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00036420 | ||||||||
Laboratory | VC | ||||||||
Person | WBPerson427 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00167255 | |||||||
WBGene00168759 | |||||||||
WBGene00022242 | |||||||||
Transcript | Y73B6BL.21d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
cDNA_position | ?-275 | ||||||||
CDS_position | ?-275 | ||||||||
Protein_position | ?-92 | ||||||||
Intron_number | 1-2/6 | ||||||||
Exon_number | 1-3/7 | ||||||||
Y73B6BL.122 | |||||||||
Y73B6BL.148 | |||||||||
Y73B6BL.21a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y73B6BL.21a.1:c.153+60_437del | ||||||||
cDNA_position | ?-446 | ||||||||
CDS_position | ?-437 | ||||||||
Protein_position | ?-146 | ||||||||
Intron_number | 2-4/9 | ||||||||
Exon_number | 3-5/10 | ||||||||
Y73B6BL.21b.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | |||||||
VEP_impact | MODIFIER | ||||||||
cDNA_position | ?-62 | ||||||||
CDS_position | ?-62 | ||||||||
Protein_position | ?-21 | ||||||||
Exon_number | 1/5 | ||||||||
Interactor | WBInteraction000504905 | ||||||||
WBInteraction000517366 | |||||||||
WBInteraction000517367 | |||||||||
WBInteraction000517368 | |||||||||
WBInteraction000517369 | |||||||||
WBInteraction000517370 | |||||||||
WBInteraction000517371 | |||||||||
WBInteraction000517372 | |||||||||
WBInteraction000517373 | |||||||||
WBInteraction000517374 | |||||||||
WBInteraction000517375 | |||||||||
Isolation | Mutagen | UV/TMP | |||||||
Description | Phenotype | WBPhenotype:0000469 | Paper_evidence | WBPaper00038522 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson7575 | |||||||||
Remark | The QL.d localized around their normal positions in sfrp-1 mutants; however, a clear change in the final position of the QR.d was observed, with the QR.d migrating significantly further into the anterior than in wildtype animals. | Paper_evidence | WBPaper00038522 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
In the sfrp-1(gk554) mutant the QR.d overmigrate, whereas the QL.d localize properly | Paper_evidence | WBPaper00038522 | |||||||
Curator_confirmed | WBPerson7575 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004056 | PATO:0000460 | Paper_evidence | WBPaper00038522 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004054 | PATO:0000460 | Paper_evidence | WBPaper00038522 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0008598 | PATO:0000460 | Paper_evidence | WBPaper00038522 | ||||||
Curator_confirmed | WBPerson7575 | ||||||||
WBPhenotype:0000471 | Paper_evidence | WBPaper00038522 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson7575 | |||||||||
Remark | ALM exhibits undermigration. | Paper_evidence | WBPaper00038522 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
the sfrp-1(gk554) mutant has undermigrated ALM neurons | Paper_evidence | WBPaper00038522 | |||||||
Curator_confirmed | WBPerson7575 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00038522 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson7575 | |||||||||
WBPhenotype:0001140 | Paper_evidence | WBPaper00038522 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | sfrp-1 mutants show clear alterations in the Wnt-dependent anteroposterior positioning of migrating neuroblasts. | sfrp-1 mutants show misplacement of the ALM and CAN neurons; the posterior migration of the ALM neurons was significantly truncated. The CAN neurons undermigrated. | Paper_evidence | WBPaper00038522 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004056 | PATO:0000460 | Paper_evidence | WBPaper00038522 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004054 | PATO:0000460 | Paper_evidence | WBPaper00038522 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00038522 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0006827 | PATO:0000460 | Paper_evidence | WBPaper00038522 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001520 | Paper_evidence | WBPaper00038522 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | sfrp-1 mutants show misplacement of the ALM and CAN neurons. In sfrp-1 mutants, the posterior migration of the ALM neurons was significantly truncated. Also, in the case of the CAN neurons, mutation of sfrp-1 induced undermigration. | Paper_evidence | WBPaper00038522 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00038522 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0006827 | PATO:0000460 | Paper_evidence | WBPaper00038522 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00038522 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | sfrp-1(gk554) is viable and does not induce obvious morphological defects. | Paper_evidence | WBPaper00038522 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000216 | Paper_evidence | WBPaper00038522 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson7575 | |||||||||
Remark | There were no defects in the specification of P12 fate. | Paper_evidence | WBPaper00038522 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
No defect in P12 specification | Paper_evidence | WBPaper00038522 | |||||||
Curator_confirmed | WBPerson7575 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004409 | PATO:0000460 | Paper_evidence | WBPaper00038522 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson7575 | |||||||||
WBPhenotype:0000470 | Paper_evidence | WBPaper00038522 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | There were no defects in the anterior migration of the HSN neurons. | Paper_evidence | WBPaper00038522 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000520 | Paper_evidence | WBPaper00038522 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | sfrp-1(gk554) does not induce obvious morphological defects. | Paper_evidence | WBPaper00038522 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000572 | Paper_evidence | WBPaper00038522 | |||||||
Curator_confirmed | WBPerson7575 | ||||||||
Remark | No defects in ALM and PLM polarity | Paper_evidence | WBPaper00038522 | ||||||
Curator_confirmed | WBPerson7575 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00038522 | ||||
Curator_confirmed | WBPerson7575 | ||||||||
WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00038522 | ||||||
Curator_confirmed | WBPerson7575 | ||||||||
WBPhenotype:0000883 | Paper_evidence | WBPaper00038522 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | There were no defects in the positioning of the nerve ring. | Paper_evidence | WBPaper00038522 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001229 | Paper_evidence | WBPaper00038522 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | There were no defects in the polarization of the mechanosensory neurons ALM and PLM. | Paper_evidence | WBPaper00038522 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00038522 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001235 | Paper_evidence | WBPaper00038522 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | There were no defects in the polarization of the division of the hypodermal seam cells V5 and T. | Paper_evidence | WBPaper00038522 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005753 | PATO:0000460 | Paper_evidence | WBPaper00038522 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001585 | Paper_evidence | WBPaper00038522 | |||||||
Curator_confirmed | WBPerson7575 | ||||||||
Remark | Mutants showed no defects in the polarization of the division of the hypodermal seam cells V5 and T. | Paper_evidence | WBPaper00038522 | ||||||
Curator_confirmed | WBPerson7575 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004890 | PATO:0000460 | Paper_evidence | WBPaper00038522 | ||||
Curator_confirmed | WBPerson7575 | ||||||||
WBbt:0004876 | PATO:0000460 | Paper_evidence | WBPaper00038522 | ||||||
Curator_confirmed | WBPerson7575 | ||||||||
WBbt:0004946 | PATO:0000460 | Paper_evidence | WBPaper00038522 | ||||||
Curator_confirmed | WBPerson7575 | ||||||||
WBbt:0004944 | PATO:0000460 | Paper_evidence | WBPaper00038522 | ||||||
Curator_confirmed | WBPerson7575 | ||||||||
Reference | WBPaper00038522 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |