WormBase Tree Display for Variation: WBVar00145900
expand all nodes | collapse all nodes | view schema
WBVar00145900 | Evidence | Paper_evidence | WBPaper00032399 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | gk529 | ||||||
Other_name | R07E5.2.1:c.81_159+22del | |||||||
HGVSg | CHROMOSOME_III:g.4407524_4407624del | |||||||
Sequence_details | SMap | S_parent | Sequence | R07E5 | ||||
Flanking_sequences | cacccgccagttgagcacatctcgtgctct | atttttttcaaaaattaattccaggtgatt | ||||||
Mapping_target | R07E5 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | gk529_external | |||||||
gk529_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00036368 | |||||||
Laboratory | VC | |||||||
Person | WBPerson427 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00011110 | ||||||
Transcript | R07E5.2.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | R07E5.2.1:c.81_159+22del | |||||||
cDNA_position | 81-? | |||||||
CDS_position | 81-? | |||||||
Protein_position | 27-? | |||||||
Intron_number | 1/3 | |||||||
Exon_number | 1/4 | |||||||
Isolation | Mutagen | UV/TMP | ||||||
Description | Phenotype | WBPhenotype:0002382 | Paper_evidence | WBPaper00048427 | ||||
Curator_confirmed | WBPerson11689 | |||||||
Phenotype_assay | Genotype | dvIs19 [Pgst-4::GFP::NLS] | Paper_evidence | WBPaper00048427 | ||||
Curator_confirmed | WBPerson11689 | |||||||
Phenotype_not_observed | WBPhenotype:0001621 | Paper_evidence | WBPaper00032399 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals were as sensitive to exposure to 1.0mM and 10mM hydrogen peroxide as wild-type animals. | Paper_evidence | WBPaper00032399 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00032399 | |||||||
WBPaper00048427 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |