WormBase Tree Display for Variation: WBVar00145460
expand all nodes | collapse all nodes | view schema
WBVar00145460 | Name | Public_name | gk3 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | ZC101.2d.1:c.9937+27_11850-6del | ||||||||
ZC101.2e.1:c.7837+27_9750-6del | |||||||||
ZC101.2g.1:c.340+27_2253-6del | |||||||||
HGVSg | CHROMOSOME_II:g.14647863_14650567del | ||||||||
Sequence_details | SMap | S_parent | Sequence | C38C6 | |||||
Flanking_sequences | cgcagctccaccaccaagttcgtagctgaa | ttaacgagaaaaaaaaattcacttacgtct | |||||||
Mapping_target | C38C6 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | gk3_external | ||||||||
gk3_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005889 | ||||||||
Laboratory | VC | ||||||||
Person | WBPerson427 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006787 | |||||||
Transcript | ZC101.2e.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC101.2e.1:c.7837+27_9750-6del | ||||||||
Intron_number | 26-34/34 | ||||||||
Exon_number | 27-34/35 | ||||||||
ZC101.2d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC101.2d.1:c.9937+27_11850-6del | ||||||||
Intron_number | 36-44/45 | ||||||||
Exon_number | 37-44/46 | ||||||||
ZC101.2g.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC101.2g.1:c.340+27_2253-6del | ||||||||
Intron_number | 2-10/10 | ||||||||
Exon_number | 3-10/11 | ||||||||
Interactor | WBInteraction000538528 | ||||||||
Isolation | Mutagen | formaldehyde | |||||||
Description | Phenotype_not_observed | WBPhenotype:0000195 | Paper_evidence | WBPaper00005809 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "The unc-52(ra515) and unc-52(gk3) alleles result from deletions of exons 15 through 18 encoding four Domain IV Ig repeats, or exons 28 through 37 encoding the C-terminal Domain V of UNC-52, respectively (Mullen et al., 1999)... DTC migrations are normal in these strains, and the frequency of DTC migration defects in double mutants of unc-52(ra515); unc-5(e152) and unc-52(gk3); unc-5(e152) are not significantly different from unc-5(e152) alone (P > 0.1; Table 1)." | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00005809 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00005809 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "The unc-52(ra515) and unc-52(gk3) alleles result from deletions of exons 15 through 18 encoding four Domain IV Ig repeats, or exons 28 through 37 encoding the C-terminal Domain V of UNC-52, respectively (Mullen et al., 1999). Neither of these alleles exhibits the severe Unc or gonadal rupture phenotypes of the class I viable unc-52 alleles." | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000691 | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "The unc-52(ra515) and unc-52(gk3) alleles result from deletions of exons 15 through 18 encoding four Domain IV Ig repeats, or exons 28 through 37 encoding the C-terminal Domain V of UNC-52, respectively (Mullen et al., 1999). Neither of these alleles exhibits the severe Unc or gonadal rupture phenotypes of the class I viable unc-52 alleles." | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00017850 | ||||||||
WBPaper00025979 | |||||||||
WBPaper00005809 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |