WormBase Tree Display for Variation: WBVar00145381
expand all nodes | collapse all nodes | view schema
WBVar00145381 | Evidence | Paper_evidence | WBPaper00004484 | ||
---|---|---|---|---|---|
Name | Public_name | g48 | |||
Other_name | CE01548:p.His384Tyr | ||||
F10B5.6.1:c.1150C>T | |||||
HGVSg | CHROMOSOME_II:g.8160841G>A | ||||
Sequence_details | SMap | S_parent | Sequence | F10B5 | |
Flanking_sequences | GTTCGTGTTCAACTTCATAGTGAAGAATAT | ACCAAAAGCCACCCATCCTTCAGCAAACGT | |||
Mapping_target | F10B5 | ||||
Type_of_mutation | Substitution | G | A | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00007841 | ||||
WBStrain00034900 | |||||
WBStrain00034901 | |||||
WBStrain00034904 | |||||
Laboratory | RC | ||||
GG | |||||
Status | Live | ||||
Affects | Gene | WBGene00001281 | |||
Transcript | F10B5.6.1 (12) | ||||
Interactor | WBInteraction000500087 | ||||
WBInteraction000500090 | |||||
WBInteraction000500093 | |||||
WBInteraction000502681 | |||||
Genetics | Interpolated_map_position | II | 0.732936 | ||
Mapping_data | In_2_point | 582 | |||
583 | |||||
In_multi_point | 485 | ||||
In_pos_neg_data (11) | |||||
Description | Phenotype (14) | ||||
Reference | WBPaper00031872 | ||||
WBPaper00033119 | |||||
WBPaper00004484 | |||||
WBPaper00022672 | |||||
WBPaper00037650 | |||||
WBPaper00011513 | |||||
WBPaper00044582 | |||||
WBPaper00065272 | |||||
Remark | [220503 skd] Corrected flanks and substitution details based on email received from Wendy Herbst: "As described in Golden et al. 2000, the mutation is c->t (ggcttttggtCatattcttc -> ggcttttggtTatattcttc), His -> Tyr (H384Y). I sequenced the g48 worms from CGC to confirm they have this mutation and NOT the mutation that is described on WormBase." Note that corrected information is referring to the positive strand sequence (skd). See GH ticket 8607. | Curator_confirmed | WBPerson51134 | ||
Method | Substitution_allele |