WormBase Tree Display for Variation: WBVar00145341
expand all nodes | collapse all nodes | view schema
WBVar00145341 | Evidence | Person_evidence | WBPerson1503 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | fj54 | |||||
Other_name | CE04431:p.Phe177GlyfsTer10 | ||||||
F20D12.1a.1:c.529_968del | |||||||
F20D12.1b.1:c.40_479del | |||||||
F57H12.4.1:c.-608+598_-608+1121del | |||||||
CE39920:p.Phe14GlyfsTer10 | |||||||
F20D12.1a.2:c.529_968del | |||||||
HGVSg | CHROMOSOME_IV:g.7958652_7959175del | ||||||
Sequence_details | SMap | S_parent | Sequence | F20D12 | |||
Flanking_sequences | aagcaaaatccaagacttgccctgaacatc | ggatattgtgacatcacagagtgccatta | |||||
Mapping_target | F20D12 | ||||||
Type_of_mutation | Deletion | ||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00040879 | ||||||
WBStrain00054546 | |||||||
WBStrain00054547 | |||||||
WBStrain00055735 | |||||||
Laboratory | ZT | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00019019 | |||||
WBGene00017641 | |||||||
Transcript | F57H12.4.1 | VEP_consequence | intron_variant | ||||
VEP_impact | MODIFIER | ||||||
HGVSc | F57H12.4.1:c.-608+598_-608+1121del | ||||||
Intron_number | 1/8 | ||||||
F20D12.1a.2 (11) | |||||||
F20D12.1a.1 (11) | |||||||
F20D12.1b.1 (11) | |||||||
Isolation | Mutagen | TMP/UV | |||||
Genetics | Interpolated_map_position | IV | 3.50893 | ||||
Description | Phenotype | WBPhenotype:0000679 | Paper_evidence | WBPaper00035228 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | PGL-1 staining in the germline differs from wild type; PGL-1 accumulates in large granules and dissociated from nuclei periphery. | Paper_evidence | WBPaper00035228 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00035228 | ||||||
WBPaper00065293 | |||||||
Method | Deletion_allele |