WormBase Tree Display for Variation: WBVar00145228
expand all nodes | collapse all nodes | view schema
WBVar00145228 | Evidence | Paper_evidence | WBPaper00005582 | ||
---|---|---|---|---|---|
Name | Public_name | ev432 | |||
Other_name (11) | |||||
HGVSg | CHROMOSOME_IV:g.5495932_5496729del | ||||
Sequence_details | SMap | S_parent | Sequence | B0273 | |
Flanking_sequences | gtttgtgtagagttccgattgccatttgga | taagctcaattttttgcacaaacacaacta | |||
Mapping_target | B0273 | ||||
Type_of_mutation (2) | |||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Laboratory | NW | ||||
Status | Live | ||||
Affects | Gene | WBGene00170205 | |||
WBGene00165816 | |||||
WBGene00045805 | |||||
WBGene00006745 | |||||
Transcript | B0273.4f.1 (11) | ||||
B0273.4e.1 (11) | |||||
B0273.4c.1 (11) | |||||
B0273.47 | |||||
B0273.4a.1 (11) | |||||
B0273.4d.2 (11) | |||||
B0273.10 | |||||
B0273.4d.1 (11) | |||||
B0273.77 | |||||
Genetics | Interpolated_map_position | IV | 1.75 | ||
Reference | WBPaper00005582 | ||||
Remark | ev432 is a V(826) to frameshift removing 93 appropriate and replacing with 69 inappropriate C-terminal residues. Substitution coordinate refers to B0273.4a | Paper_evidence | WBPaper00005582 | ||
Method | Deletion_and_insertion_allele |