WormBase Tree Display for Variation: WBVar00145224
expand all nodes | collapse all nodes | view schema
WBVar00145224 | Name | Public_name | ev400 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | CE04538:p.Gln99Ter | ||||||||
F41C6.1.1:c.295C>T | |||||||||
F41C6.1.2:c.295C>T | |||||||||
HGVSg | CHROMOSOME_X:g.6890534C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F41C6 | |||||
Flanking_sequences | tgtgacacttgtgatgctagaaaccatttc | aatcccatccagcctctcttctaactgatc | |||||||
Mapping_target | F41C6 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002378 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (69) | |||||||||
Laboratory | NW | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006746 | |||||||
Transcript | F41C6.1.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F41C6.1.1:c.295C>T | ||||||||
HGVSp | CE04538:p.Gln99Ter | ||||||||
cDNA_position | 361 | ||||||||
CDS_position | 295 | ||||||||
Protein_position | 99 | ||||||||
Exon_number | 4/15 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
F41C6.1.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F41C6.1.2:c.295C>T | ||||||||
HGVSp | CE04538:p.Gln99Ter | ||||||||
cDNA_position | 361 | ||||||||
CDS_position | 295 | ||||||||
Protein_position | 99 | ||||||||
Exon_number | 4/16 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor (31) | |||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | X | -2.1004 | ||||||
Mapping_data | In_multi_point | 4795 | |||||||
Description | Phenotype (24) | ||||||||
Phenotype_not_observed | WBPhenotype:0000104 | Paper_evidence | WBPaper00033081 | ||||||
WBPaper00004437 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson2987 | |||||||||
Remark | Polarity is normal in all mutants | Paper_evidence | WBPaper00033081 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
"Using MIG-2::GFP, we confirmed that Q cell polarization in unc-6 mutants was also normal (data not shown)." | Paper_evidence | WBPaper00004437 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00033081 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations (2) | |||||||||
Phenotype_assay | Genotype | kuIs47 [AJM-1::GFP] | Paper_evidence | WBPaper00033081 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
MIG-2::GFP | Paper_evidence | WBPaper00004437 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000220 | Paper_evidence | WBPaper00033081 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | zmp-1 and lin-3 markers are expressed in the correct cell at the expected time in over 90% of the mutants | Paper_evidence | WBPaper00033081 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00033081 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | syIs107[lin-3(delta-pes-10)::GFP], syIs49[zmp- 1::GFP] | Paper_evidence | WBPaper00033081 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00046107 | |||||||
Curator_confirmed | WBPerson10038 | ||||||||
Remark | From the text: "To examine whether the axonal distribution of UNC-6 by IRE-1 was required for UNC-6-mediated axon guidance, we generated worms in which UNC-6 was expressed only in the ventral neurons. We used the glr-1 promoter (Hart et al . 1995) to drive unc-6 gene expression in the ventral neurons in unc-6 null mutants. In these worms, UNC-6 was observed in the axons and cell bodies (Fig. 2D)." | Paper_evidence | WBPaper00046107 | ||||||
Curator_confirmed | WBPerson10038 | ||||||||
Phenotype_assay | Genotype | [ghEx15(glr-1p::unc-6::Venus; tph-1p::GFP)] | Paper_evidence | WBPaper00046107 | |||||
Curator_confirmed | WBPerson10038 | ||||||||
WBPhenotype:0000469 | Paper_evidence | WBPaper00004437 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We found that in the null allele unc-6 (ev400) (Ishii et al., 1992), the Q cells still migrated almost as far as they do in wild type (Fig. 2)." | Paper_evidence | WBPaper00004437 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations (2) | |||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00032446 | |||||||
WBPaper00036484 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | PAR-3::GFP, which localizes to apical and lateral membranes in wild-type ACs and AJM-1::GFP which marks nascent apical spot junctions, were normal in unc-6 mutants | Paper_evidence | WBPaper00032446 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
MADD-2::GFP was excluded from the dorsal ADL branch and was present at high levels in the cell body, a pattern that was also observed in control animals. | Paper_evidence | WBPaper00036484 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005661 | PATO:0000460 | Paper_evidence | WBPaper00036484 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | zuIs20 [par-3::GFP] , jcIs1[ajm-1::GFP] | Paper_evidence | WBPaper00032446 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000717 | Paper_evidence | WBPaper00032446 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Transcriptional reporters for FOS-1A and two of its downstream targets, ZMP-1, a matrix metalloproteinase, and hemicentin (HIM-4), a conserved extracellular matrix protein, were expressed normally in unc-6 mutants | Paper_evidence | WBPaper00032446 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | rhIs23[hemicentin::GFP], qyIs17[zmp-1p::mCherry], syIs77[zmp-1::YFP] | Paper_evidence | WBPaper00032446 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001930 | Paper_evidence | WBPaper00032907 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Ventral muscle arm extension in animals was indistinguishable from that of wild-type controls. | Paper_evidence | WBPaper00032907 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (40) | |||||||||
Method | Substitution_allele |