WormBase Tree Display for Variation: WBVar00145093
expand all nodes | collapse all nodes | view schema
| WBVar00145093 | Evidence | Paper_evidence | WBPaper00033166 | ||||
|---|---|---|---|---|---|---|---|
| WBPaper00002306 | |||||||
| Name | Public_name | ed3 | |||||
| Other_name | M142.1a.1:c.337C>T | ||||||
| CE06203:p.Arg113Ter | |||||||
| CE44343:p.Arg138Ter | |||||||
| M142.1c.1:c.412C>T | |||||||
| CE43523:p.Arg93Ter | |||||||
| M142.1b.1:c.277C>T | |||||||
| HGVSg | CHROMOSOME_III:g.10907944C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | M142 | |||
| Flanking_sequences | caagccgaatcggcaagatatgtccgatat | gatttgcgccgaattttctgaaattaaagac | |||||
| Mapping_target | M142 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00033166 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Engineered_allele | ||||||
| Allele | |||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain (1824) | |||||||
| Laboratory (14) | |||||||
| Production_method | CRISPR_Cas9 | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006843 | |||||
| Transcript | M142.1a.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | M142.1a.1:c.337C>T | ||||||
| HGVSp | CE06203:p.Arg113Ter | ||||||
| cDNA_position | 351 | ||||||
| CDS_position | 337 | ||||||
| Protein_position | 113 | ||||||
| Exon_number | 4/6 | ||||||
| Codon_change | Cga/Tga | ||||||
| Amino_acid_change | R/* | ||||||
| M142.1c.1 | VEP_consequence | stop_gained | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | M142.1c.1:c.412C>T | ||||||
| HGVSp | CE44343:p.Arg138Ter | ||||||
| cDNA_position | 419 | ||||||
| CDS_position | 412 | ||||||
| Protein_position | 138 | ||||||
| Exon_number | 5/7 | ||||||
| Codon_change | Cga/Tga | ||||||
| Amino_acid_change | R/* | ||||||
| M142.1b.1 | VEP_consequence | stop_gained | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | M142.1b.1:c.277C>T | ||||||
| HGVSp | CE43523:p.Arg93Ter | ||||||
| cDNA_position | 277 | ||||||
| CDS_position | 277 | ||||||
| Protein_position | 93 | ||||||
| Exon_number | 2/4 | ||||||
| Codon_change | Cga/Tga | ||||||
| Amino_acid_change | R/* | ||||||
| Interactor | WBInteraction000504894 | ||||||
| WBInteraction000504895 | |||||||
| Description | Phenotype | WBPhenotype:0001213 | Paper_evidence | WBPaper00002306 | |||
| Curator_confirmed | WBPerson48 | ||||||
| Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00002306 | ||||
| Curator_confirmed | WBPerson48 | ||||||
| Reference (28) | |||||||
| Remark | The following mutations were used:unc-119(ed3R113Stop)is a loss-of-function mutation that causes a strong uncoordi-nated phenotype and an inability to form dauer larvae(Maduroand Pilgrim1995). | Paper_evidence | WBPaper00033166 | ||||
| Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||||
| Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||
| Method | Engineered_allele |
