WormBase Tree Display for Variation: WBVar00145037
expand all nodes | collapse all nodes | view schema
WBVar00145037 | Name | Public_name | e2890 | ||||
---|---|---|---|---|---|---|---|
Other_name | F23H12.4b.1:c.674G>A | ||||||
CE05707:p.Gly291Glu | |||||||
F23H12.4a.1:c.872G>A | |||||||
CE46560:p.Gly225Glu | |||||||
HGVSg | CHROMOSOME_V:g.12354046G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | F23H12 | |||
Flanking_sequences | tgtaatatttcaggtattgcgctctcgatg | aggagtcttcttcgaggacggaaccagacg | |||||
Mapping_target | F23H12 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00024637 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin (3) | |||||||
Affects | Gene | WBGene00005018 | |||||
Transcript | F23H12.4a.1 (12) | ||||||
F23H12.4b.1 (12) | |||||||
Isolation | Mutagen | ENU | Paper_evidence | WBPaper00024637 | |||
Genetics | Interpolated_map_position | V | 4.00901 | ||||
Remark | This allele has the same nucleotide mutation (and hence the same amino acid change) at the same position as sc8, but was mutated by the a different mutagen. | Paper_evidence | WBPaper00024637 | ||||
Method | Substitution_allele |