WormBase Tree Display for Variation: WBVar00145035

WBVar00145035 Name: Public_name: e2888
    Other_name: F23H12.4b.1:c.674G>A
      CE05707:p.Gly291Glu
      F23H12.4a.1:c.872G>A
      CE46560:p.Gly225Glu
    HGVSg: CHROMOSOME_V:g.12354046G>A
  Sequence_details: SMap: S_parent: Sequence: F23H12
    Flanking_sequences: tgtaatatttcaggtattgcgctctcgatg aggagtcttcttcgaggacggaaccagacg
    Mapping_target: F23H12
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00024637
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00005018
    Transcript: F23H12.4a.1 VEP_consequence: missense_variant
        VEP_impact: MODERATE
        SIFT: 0 deleterious
        PolyPhen: 0 unknown
        HGVSc: F23H12.4a.1:c.872G>A
        HGVSp: CE05707:p.Gly291Glu
        cDNA_position: 1148
        CDS_position: 872
        Protein_position: 291
        Exon_number: 4/5
        Codon_change: gGa/gAa
        Amino_acid_change: G/E
      F23H12.4b.1 (12)
  Isolation: Mutagen: EMS Paper_evidence: WBPaper00024637
  Genetics: Interpolated_map_position: V 4.00901
  Remark: This allele has the same nucleotide mutation (and hence the same amino acid change) at the same position as sc8, and was mutated by the same mutagen. Paper_evidence: WBPaper00024637
  Method: Substitution_allele