WormBase Tree Display for Variation: WBVar00145034
expand all nodes | collapse all nodes | view schema
WBVar00145034 | Evidence | Paper_evidence | WBPaper00031667 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e2887 | ||||||
Other_name | CE54583:p.Gly333Asp | |||||||
CE28488:p.Gly319Asp | ||||||||
T23F2.1b.1:c.998G>A | ||||||||
T23F2.1a.1:c.956G>A | ||||||||
HGVSg | CHROMOSOME_X:g.5494994G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | T23F2 | ||||
Flanking_sequences | gaagaccggttattgtctgtgatagtggag | cccagctgaaaccgtcttggaagatatta | ||||||
Mapping_target | T23F2 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00031667 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004685 | |||||||
WBStrain00004686 | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00044623 | ||||||
Transcript | T23F2.1b.1 | VEP_consequence | missense_variant | |||||
VEP_impact | MODERATE | |||||||
HGVSc | T23F2.1b.1:c.998G>A | |||||||
HGVSp | CE54583:p.Gly333Asp | |||||||
cDNA_position | 998 | |||||||
CDS_position | 998 | |||||||
Protein_position | 333 | |||||||
Exon_number | 7/9 | |||||||
Codon_change | gGc/gAc | |||||||
Amino_acid_change | G/D | |||||||
T23F2.1a.1 (12) | ||||||||
Genetics | Interpolated_map_position | X | -5.24078 | |||||
Description | Phenotype | WBPhenotype:0000010 | Paper_evidence | WBPaper00031667 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals show strongly enhanced sensitivity to drugs of a variety of sizes and structures. | Paper_evidence | WBPaper00031667 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Gravid hermaphrodites were placed into wells (of 96-well plates) containing the compound. Sensitivity was assessed based on the time until paralysis ensued. Concentrations of the compounds are as follows: Nicotine, 0.1%v/v in M9; 1-Phenoxypropan-2-ol , 0.1% or 0.5% in M9; Ivermectin dissolved in DMSO and diluted to 2.5ug/ml in M9. | Paper_evidence | WBPaper00031667 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000050 | Paper_evidence | WBPaper00031667 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Some embryonic lethality is observed. | Paper_evidence | WBPaper00031667 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00031667 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Cold_sensitive | 15 | Paper_evidence | WBPaper00031667 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 15 | Paper_evidence | WBPaper00031667 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000054 | Paper_evidence | WBPaper00031667 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Postembryonic escapers completely arrest at the larval stage at the non-permissive temperature (15C). | Paper_evidence | WBPaper00031667 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Cold_sensitive | 15 | Paper_evidence | WBPaper00031667 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 22.5, 15 | Paper_evidence | WBPaper00031667 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000523 | Paper_evidence | WBPaper00031667 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals show increased permeability to the dye Hoechst 33258. | Paper_evidence | WBPaper00031667 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Hoechst 33258 staining was as described in Moribe et al 2004. | Paper_evidence | WBPaper00031667 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000638 | Paper_evidence | WBPaper00031667 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Molting defects are observed, such as body restriction points, due to incomplete cuticle shedding. | Paper_evidence | WBPaper00031667 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Cold_sensitive | 15 | Paper_evidence | WBPaper00031667 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 22.5, 15 | Paper_evidence | WBPaper00031667 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000899 | Paper_evidence | WBPaper00031667 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Epithelial cell layer between the cuticle and body wall muscle is disorganized, vacuolated and much wider than in wild-type, as visualized by electron microscopy. More specifically the fibrous organelles are disordered. | Paper_evidence | WBPaper00031667 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001209 | Paper_evidence | WBPaper00031667 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals are severly Unc. | Paper_evidence | WBPaper00031667 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001413 | Paper_evidence | WBPaper00031667 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000025 | Paper_evidence | WBPaper00031667 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Despite defects in the epithelial layer between the cuticle and muscle, animals are not blistered. | Paper_evidence | WBPaper00031667 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000948 | Paper_evidence | WBPaper00031667 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The cuticle is grossly normal. | Paper_evidence | WBPaper00031667 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00031667 | |||||||
Method | Substitution_allele |