WormBase Tree Display for Variation: WBVar00145033

WBVar00145033 Evidence: Paper_evidence: WBPaper00031667
  Name: Public_name: e2885
    Other_name: T23F2.1a.1:c.932C>T
      CE54583:p.Pro325Leu
      T23F2.1b.1:c.974C>T
      CE28488:p.Pro311Leu
    HGVSg: CHROMOSOME_X:g.5494970C>T
  Sequence_details: SMap: S_parent: Sequence: T23F2
    Flanking_sequences: tcccaattgaggctttggatcaaagaagac ggttattgtctgtgatagtggaggcccagc
    Mapping_target: T23F2
    Type_of_mutation: Substitution: c t Paper_evidence: WBPaper00031667
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00004684
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00044623
    Transcript: T23F2.1b.1 VEP_consequence: missense_variant
        VEP_impact: MODERATE
        HGVSc: T23F2.1b.1:c.974C>T
        HGVSp: CE54583:p.Pro325Leu
        cDNA_position: 974
        CDS_position: 974
        Protein_position: 325
        Exon_number: 7/9
        Codon_change: cCg/cTg
        Amino_acid_change: P/L
      T23F2.1a.1 (12)
  Genetics: Interpolated_map_position: X -5.24089
  Description: Phenotype: WBPhenotype:0000010 Paper_evidence: WBPaper00031667
        Curator_confirmed: WBPerson712
        Remark: Animals show weak but significant enhanced sensitivity to drugs of a variety of sizes and structures. Paper_evidence: WBPaper00031667
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Gravid hermaphrodites were placed into wells (of 96-well plates) containing the compound. Sensitivity was assessed based on the time until paralysis ensued. Concentrations of the compounds are as follows: Nicotine, 0.1%v/v in M9; 1-Phenoxypropan-2-ol , 0.1% or 0.5% in M9; Ivermectin dissolved in DMSO and diluted to 2.5ug/ml in M9. Paper_evidence: WBPaper00031667
              Curator_confirmed: WBPerson712
      WBPhenotype:0000054 Paper_evidence: WBPaper00031667
        Curator_confirmed: WBPerson712
        Remark: Animals show weak larval lethality. Paper_evidence: WBPaper00031667
            Curator_confirmed: WBPerson712
        Phenotype_assay: Temperature: 22.5 Paper_evidence: WBPaper00031667
              Curator_confirmed: WBPerson712
      WBPhenotype:0001209 Paper_evidence: WBPaper00031667
        Curator_confirmed: WBPerson712
        Remark: Animals are weakly Unc. Paper_evidence: WBPaper00031667
            Curator_confirmed: WBPerson712
      WBPhenotype:0001413 Paper_evidence: WBPaper00031667
        Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000050 Paper_evidence: WBPaper00031667
        Curator_confirmed: WBPerson712
  Reference: WBPaper00031667
  Method: Substitution_allele