WormBase Tree Display for Variation: WBVar00145009
expand all nodes | collapse all nodes | view schema
| WBVar00145009 | Name | Public_name | e2806 | ||
|---|---|---|---|---|---|
| Other_name | T09E8.2.1:c.669G>A | ||||
| CE13489:p.Met223Ile | |||||
| HGVSg | CHROMOSOME_V:g.13177520G>A | ||||
| Sequence_details | SMap | S_parent | Sequence | T09E8 | |
| Flanking_sequences | ttgtggtagagacggccctcttgcaaccat | cttcctttcattagagtgagacatggtcac | |||
| Mapping_target | T09E8 | ||||
| Type_of_mutation | Substitution | g | m | ||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00004670 | ||||
| Laboratory | CB | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00001874 | |||
| Transcript | T09E8.2.1 (12) | ||||
| Genetics | Interpolated_map_position | V | 4.96594 | ||
| Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00001874 Missense 223 M to I | Paper_evidence | WBPaper00024355 | ||
| Method | Substitution_allele |
