WormBase Tree Display for Variation: WBVar00144938
expand all nodes | collapse all nodes | view schema
| WBVar00144938 | Name | Public_name | e2707 | ||||
|---|---|---|---|---|---|---|---|
| Other_name | T09E8.2.1:c.2584C>T | ||||||
| CE13489:p.Arg862Ter | |||||||
| HGVSg | CHROMOSOME_V:g.13179675C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | T09E8 | |||
| Flanking_sequences | tagatcgaaaccgagttgaacttccacgga | gaaacgattcattgcttcgcagagaaaatc | |||||
| Mapping_target | T09E8 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00024355 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00004645 | ||||||
| Laboratory | CB | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00001874 | |||||
| Transcript | T09E8.2.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | T09E8.2.1:c.2584C>T | ||||||
| HGVSp | CE13489:p.Arg862Ter | ||||||
| cDNA_position | 2584 | ||||||
| CDS_position | 2584 | ||||||
| Protein_position | 862 | ||||||
| Exon_number | 9/10 | ||||||
| Codon_change | Cga/Tga | ||||||
| Amino_acid_change | R/* | ||||||
| Interactor | WBInteraction000501539 | ||||||
| Genetics | Interpolated_map_position | V | 4.96853 | ||||
| Description | Phenotype | WBPhenotype:0000276 | Paper_evidence | WBPaper00031923 | |||
| Curator_confirmed | WBPerson2987 | ||||||
| Remark | "three doses of 1 Gy or 3 Gy X-rays slightly increased lethality in the wild-type N2 (1-2%) and decreased lethality by half in the him-17 strain (Fig. 3A,B)... In the wild-type N2 background, a few males were produced following X irradiation but not SMF exposure (Fig. 3C). The percentage of males produced in the him-17 strain did not change following SMF exposure, whereas the male production rate significantly decreased following X irradiation (Fig. 3D)." | Paper_evidence | WBPaper00031923 | ||||
| Curator_confirmed | WBPerson2987 | ||||||
| Reference | WBPaper00031923 | ||||||
| Method | Substitution_allele |
