WormBase Tree Display for Variation: WBVar00144920

WBVar00144920 Evidence: Paper_evidence: WBPaper00026735
  Name: Public_name: e2689
    Other_name: M02B1.1a.1:c.388C>T
      M02B1.1c.1:c.16C>T
      M02B1.1b.1:c.268C>T
      CE43555:p.Gln130Ter
      CE45668:p.Gln6Ter
      CE37656:p.Gln90Ter
    HGVSg: CHROMOSOME_IV:g.12851646C>T
  Sequence_details: SMap: S_parent: Sequence: M02B1
    Flanking_sequences: gtttgcattcccgccatgatctacatagtt aaaataatcttttctacgtggcagcttcac
    Mapping_target: M02B1
    Type_of_mutation: Substitution: c t Paper_evidence: WBPaper00013440
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00004702
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00005153
    Transcript: M02B1.1b.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: M02B1.1b.1:c.268C>T
        HGVSp: CE37656:p.Gln90Ter
        cDNA_position: 268
        CDS_position: 268
        Protein_position: 90
        Exon_number: 3/6
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      M02B1.1a.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: M02B1.1a.1:c.388C>T
        HGVSp: CE43555:p.Gln130Ter
        cDNA_position: 400
        CDS_position: 388
        Protein_position: 130
        Exon_number: 5/9
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      M02B1.1c.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: M02B1.1c.1:c.16C>T
        HGVSp: CE45668:p.Gln6Ter
        cDNA_position: 16
        CDS_position: 16
        Protein_position: 6
        Exon_number: 1/4
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
    Interactor: WBInteraction000008514
  Genetics: Interpolated_map_position: IV 6.37322
  Description: Phenotype: WBPhenotype:0001413 Paper_evidence: WBPaper00026735
          WBPaper00024246
        Curator_confirmed: WBPerson48
          WBPerson712
        Remark: 0% animals have a deformed anal region (Dar) (20C, n=460). Paper_evidence: WBPaper00024246
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0006919 PATO:0000460 Paper_evidence: WBPaper00024246
                Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Animals were grown on plates containing Microbacterium nematophilum strain CBX102. Paper_evidence: WBPaper00024246
              Curator_confirmed: WBPerson712
          Temperature: 20 Paper_evidence: WBPaper00024246
              Curator_confirmed: WBPerson712
      WBPhenotype:0001420 Paper_evidence: WBPaper00024246
        Curator_confirmed: WBPerson712
        Remark: As assayed by DIC microscopy for the presence of biofilm adherent to the head of the animal, in addition to assaying the number animals that reached L4 after two days of growth at 20. 100% reach L4 after two days at 20C (n=725). Paper_evidence: WBPaper00024246
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Animals were grown on plates containing Yersinia pseudotuberculosis. Paper_evidence: WBPaper00024246
              Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0001384 Paper_evidence: WBPaper00024246
        Curator_confirmed: WBPerson712
        Remark: Brood sizes were not significantly different between populations of mutants grown on E.coli versus grown on M. nematophilum, whereas there is a 50% decrease in brood size for N2 worms. Paper_evidence: WBPaper00024246
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Animals were grown on plates containing 0.1% Microbacterium nematophilum CBX102. Paper_evidence: WBPaper00024246
              Curator_confirmed: WBPerson712
  Reference: WBPaper00024246
    WBPaper00026735
  Method: Substitution_allele