WormBase Tree Display for Variation: WBVar00144905

WBVar00144905 Evidence: Paper_evidence: WBPaper00003886
  Name: Public_name: e2663
    Other_name: Y41C4A.14.2:c.256-1G>A
      Y41C4A.14.1:c.256-1G>A
    HGVSg: CHROMOSOME_III:g.11747433G>A
  Sequence_details: SMap: S_parent: Sequence: Y41C4A
    Flanking_sequences: aaaaaagtggcaaaaaacaaaaaaattcca gaattcctgagcatttcggaaaactcgtcg
    Mapping_target: Y41C4A
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00003886
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00004639
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00003417
    Transcript: Y41C4A.14.2 VEP_consequence: splice_acceptor_variant
        VEP_impact: HIGH
        HGVSc: Y41C4A.14.2:c.256-1G>A
        Intron_number: 3/8
      Y41C4A.14.1 VEP_consequence: splice_acceptor_variant
        VEP_impact: HIGH
        HGVSc: Y41C4A.14.1:c.256-1G>A
        Intron_number: 4/9
    Interactor: WBInteraction000008923
      WBInteraction000051783
      WBInteraction000051785
      WBInteraction000501814
      WBInteraction000520835
      WBInteraction000521796
  Genetics: Interpolated_map_position: III 12.0719
    Mapping_data: In_multi_point: 4497
  Description: Phenotype: WBPhenotype:0000436 Paper_evidence: WBPaper00005597
        Curator_confirmed: WBPerson712
        Remark: The expression of HUS-1::GFP in the germline was greatly reduced than in control animals and was excluded from the nucleus. This reduction of expression is likely due to degradation, possibly as a result of improper localization, rather than transcriptional regulation, as GFP under the control of the hus-1 promoter (opIs29(pRH04)) was not affected by loss of MRT-2 (data not shown). Paper_evidence: WBPaper00005597
            Curator_confirmed: WBPerson712
      WBPhenotype:0000711 Paper_evidence: WBPaper00003886
        Curator_confirmed: WBPerson712
      WBPhenotype:0000739 Paper_evidence: WBPaper00003886
        Curator_confirmed: WBPerson712
        Remark: Animals are sensitive to DNA damage, as assayed by 2-3X increase in level of lethality among progeny of animals subjected to high levels of mut-2 transposon activity. Paper_evidence: WBPaper00003886
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: mut-2(r459) Paper_evidence: WBPaper00003886
              Curator_confirmed: WBPerson712
      WBPhenotype:0000966 Paper_evidence: WBPaper00003886
        Curator_confirmed: WBPerson712
      WBPhenotype:0001175 Paper_evidence: WBPaper00003886
        Curator_confirmed: WBPerson712
        Remark: Animals display a weak Him phenotype, producing 0.9 0.6% males (n=25), meaured in F3 broods. Paper_evidence: WBPaper00003886
            Curator_confirmed: WBPerson712
      WBPhenotype:0001756 Paper_evidence: WBPaper00029176
        Curator_confirmed: WBPerson557
        Remark: UV-C-induced germ cell apoptosis was strongly reduced but not abolished in mrt-2(e2663) mutants. Paper_evidence: WBPaper00029176
            Curator_confirmed: WBPerson557
        Phenotype_assay: Treatment: Germ cell apoptosis was measured following exposure to 100 joules per square meter UV-C. Paper_evidence: WBPaper00029176
              Curator_confirmed: WBPerson557
      WBPhenotype:0001851 Paper_evidence: WBPaper00027700
        Curator_confirmed: WBPerson2021
        Remark: These mutants are significantly radiosensitive compared with N2 C. elegans. Radiation induced vulval cell loss causes vulval abnormalities (Pvl/ Vul) Paper_evidence: WBPaper00027700
            Curator_confirmed: WBPerson2021
        Variation_effect: Probable_null_via_phenotype: Paper_evidence: WBPaper00027700
            Curator_confirmed: WBPerson2021
        EQ_annotations: Anatomy_term: WBbt:0006748 PATO:0000460 Paper_evidence: WBPaper00027700
                Curator_confirmed: WBPerson2021
          Life_stage: WBls:0000041 PATO:0000460 Paper_evidence: WBPaper00027700
                Curator_confirmed: WBPerson2021
        Phenotype_assay: Treatment: 100-400 Gy radiation Paper_evidence: WBPaper00027700
              Curator_confirmed: WBPerson2021
    Phenotype_not_observed: WBPhenotype:0000275 Paper_evidence: WBPaper00003886
        Curator_confirmed: WBPerson712
        Remark: Germ line of animals are not significantly hypersensitive to UV light (data not shown) Paper_evidence: WBPaper00003886
            Curator_confirmed: WBPerson712
      WBPhenotype:0001760 Paper_evidence: WBPaper00031945
        Curator_confirmed: WBPerson712
        Remark: No increase in deletion frequency over wild-type was observed for the endogenous qua375 sequence as determined by PCR. At least 24 populations of 5 animals were assayed. Paper_evidence: WBPaper00031945
            Curator_confirmed: WBPerson712
        Phenotype_assay: Genotype: pkIs2165[pRP1878: hsp-16.41::ATG-(C)23-stops-LacZ unc-119] or pkIs2172 [pRP1889: hsp-16.41::ATG-(monoA)-stops-LacZ unc-119] Paper_evidence: WBPaper00031945
              Curator_confirmed: WBPerson712
      WBPhenotype:0001946 Paper_evidence: WBPaper00031318
        Curator_confirmed: WBPerson712
        Remark: The extent of diphosphorylated activated form of MPK-1 (dpMPK-1) staining and the proportion of pachytene-stage germ cells is similar to wild type. Paper_evidence: WBPaper00031318
            Curator_confirmed: WBPerson712
  Reference (13)
  Method: Substitution_allele