WormBase Tree Display for Variation: WBVar00144876
expand all nodes | collapse all nodes | view schema
WBVar00144876 | Evidence | Paper_evidence | WBPaper00002188 | ||||
---|---|---|---|---|---|---|---|
Name (3) | |||||||
Sequence_details | SMap | S_parent | Sequence | F49E8 | |||
Flanking_sequences | ctgctcagagacatcccagcttcagccgct | atatgaatatctaaaaaagaaattctctgg | |||||
Mapping_target | F49E8 | ||||||
Type_of_mutation | Deletion | tatctttcagt | Paper_evidence | WBPaper00002188 | |||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00004627 | ||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00000996 | |||||
Transcript | F49E8.5.2 | VEP_consequence | frameshift_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | F49E8.5.2:c.547_557del | ||||||
HGVSp | CE28408:p.Tyr183IlefsTer2 | ||||||
cDNA_position | 588-598 | ||||||
CDS_position | 547-557 | ||||||
Protein_position | 183-186 | ||||||
Exon_number | 4/6 | ||||||
Codon_change | TATCTTTCAGTa/a | ||||||
Amino_acid_change | YLSV/X | ||||||
F49E8.5.1 | VEP_consequence | frameshift_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | F49E8.5.1:c.547_557del | ||||||
HGVSp | CE28408:p.Tyr183IlefsTer2 | ||||||
cDNA_position | 557-567 | ||||||
CDS_position | 547-557 | ||||||
Protein_position | 183-186 | ||||||
Exon_number | 3/5 | ||||||
Codon_change | TATCTTTCAGTa/a | ||||||
Amino_acid_change | YLSV/X | ||||||
Genetics | Interpolated_map_position | IV | 3.35413 | ||||
Mapping_data | In_multi_point | 2022 | |||||
2023 | |||||||
2025 | |||||||
2026 | |||||||
In_pos_neg_data | 5935 | ||||||
Description | Phenotype | WBPhenotype:0000052 | Person_evidence | WBPerson261 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | maternal-effect embryonic lethal (mn); embryos arrest at the completion of gastrulation with little or no tissue differentiation; probable null | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00002188 | ||||||
Method | Deletion_allele |