WormBase Tree Display for Variation: WBVar00144863
expand all nodes | collapse all nodes | view schema
WBVar00144863 | Name | Public_name | e2519 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | e2519mat | |||||||
ZC395.2.1:c.442G>A | ||||||||
CE01438:p.Glu148Lys | ||||||||
HGVSg | CHROMOSOME_III:g.5278926G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | ZC395 | ||||
Flanking_sequences | ctgaaaattctcacaagattacgtgatgag | agcttcatcatcatgatactggagtagaac | ||||||
Mapping_target | ZC395 | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004607 | |||||||
WBStrain00026641 | ||||||||
WBStrain00026663 | ||||||||
WBStrain00026675 | ||||||||
WBStrain00026678 | ||||||||
WBStrain00026679 | ||||||||
WBStrain00026680 | ||||||||
WBStrain00026681 | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000536 | ||||||
Transcript | ZC395.2.1 (12) | |||||||
Interactor | WBInteraction000008544 | |||||||
WBInteraction000008545 | ||||||||
WBInteraction000051700 | ||||||||
WBInteraction000504935 | ||||||||
WBInteraction000520617 | ||||||||
WBInteraction000524898 | ||||||||
WBInteraction000524899 | ||||||||
Genetics | Interpolated_map_position | III | -1.8467 | |||||
Mapping_data | In_multi_point | 2741 | ||||||
2744 | ||||||||
2755 | ||||||||
3304 | ||||||||
Description | Phenotype (15) | |||||||
Phenotype_not_observed | WBPhenotype:0001068 | Paper_evidence | WBPaper00031241 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Pre-exposure to mianserin blocked serotonin-induced egg laying as it does in N2. | Paper_evidence | WBPaper00031241 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Pre-exposure to 50uM mianserin. | Paper_evidence | WBPaper00031241 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001653 | Paper_evidence | WBPaper00026674 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table 3 | Paper_evidence | WBPaper00026674 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00003022 | Paper_evidence | WBPaper00026674 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001775 | Paper_evidence | WBPaper00031942 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Like wild-type, growth under thermocycling conditions of 10 minute shifts between 12C and 25C, resulted in a shift in life span more similar to the extended life span of animals reared at 12.5C continuously. | Paper_evidence | WBPaper00031942 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were grown in microfuge tubes in 100l S medium (maintained) and incubated in thermocyclers. Worms were transferred into autoclaved, sterile microfuge tubes either every other day or once every 3 days, dependent upon the strain and stage of life of the worms used. Worms were monitored, counted and fed on a daily basis. Animals were shifted every 10 minutes between 12C and 25C. | Paper_evidence | WBPaper00031942 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 12, 12.5, 18.5, 25 | Paper_evidence | WBPaper00031942 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001789 | Paper_evidence | WBPaper00031942 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals displayed basically the same overall pattern as observed with wild-type animals in that animals were short lived at 25C and long lived at 12.5C. | Paper_evidence | WBPaper00031942 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Animals were grown in microfuge tubes in 100l S medium (maintained) and incubated in thermocyclers. Worms were transferred into autoclaved, sterile microfuge tubes either every other day or once every 3 days, dependent upon the strain and stage of life of the worms used. Worms were monitored, counted and fed on a daily basis. Animals were shifted every 10 minutes between 12C and 25C. | Paper_evidence | WBPaper00031942 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 12, 12.5, 18.5, 25 | Paper_evidence | WBPaper00031942 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001991 | Paper_evidence | WBPaper00034694 | ||||||
Curator_confirmed | WBPerson2857 | |||||||
Remark | animals enter into hypoxia-induced reproductive and developmental diapause same as wild-type | Paper_evidence | WBPaper00034694 | |||||
Curator_confirmed | WBPerson2857 | |||||||
Reference (28) | ||||||||
Method | Substitution_allele |