WormBase Tree Display for Variation: WBVar00144862
expand all nodes | collapse all nodes | view schema
| WBVar00144862 | Evidence | Paper_evidence | WBPaper00005463 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | e2518 | |||||
| Other_name | C32C4.5a.1:c.113G>T | ||||||
| CE31427:p.Cys38Phe | |||||||
| HGVSg | CHROMOSOME_V:g.10633998G>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | C32C4 | |||
| Flanking_sequences | taacactgaactacttcagatgctctttat | tgcattaaataccaaacgacgagcattaga | |||||
| Mapping_target | C32C4 | ||||||
| Type_of_mutation | Substitution | g | t | Paper_evidence | WBPaper00005463 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | SNP | ||||||
| Natural_variant | |||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00004605 | ||||||
| WBStrain00023665 | |||||||
| Laboratory | CB | ||||||
| History | Acquires_merge | WBVar01473647 | |||||
| WBVar01473879 | |||||||
| WBVar01473894 | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00003114 | |||||
| Transcript | C32C4.5a.1 (12) | ||||||
| Genetics | Mapping_data | In_2_point | 5803 | ||||
| In_multi_point | 1918 | ||||||
| In_pos_neg_data | 5804 | ||||||
| 5805 | |||||||
| Description | Phenotype | WBPhenotype:0000070 | Paper_evidence | WBPaper00002770 | |||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000297 | Paper_evidence | WBPaper00004071 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | rays indistinct | Paper_evidence | WBPaper00004071 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000506 | Paper_evidence | WBPaper00004071 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Male tail very swollen. Vancouver wild isolate KR314 is naturally homozygous for e2518. | Paper_evidence | WBPaper00004071 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000692 | Paper_evidence | WBPaper00005463 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | "mab-23(bx118) and (e2518) males are unable to sire progeny,..." | Paper_evidence | WBPaper00005463 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00005463 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Phenotype_not_observed | WBPhenotype:0001025 | Paper_evidence | WBPaper00002770 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | No phenotype in hermaphrodite, male tail very swollen, rays indistinct. ME0. | Paper_evidence | WBPaper00002770 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00005463 | ||||||
| WBPaper00002770 | |||||||
| WBPaper00004071 | |||||||
| Remark | [2023-04-26T23:02:28.95Z WBPerson51134] Update Variation: https: | ||||||
| Method | SNP |
