WormBase Tree Display for Variation: WBVar00144812
expand all nodes | collapse all nodes | view schema
WBVar00144812 | Evidence | Paper_evidence | WBPaper00031616 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e2410 | ||||||
Other_name | T27A1.6.1:c.407+1G>A | |||||||
HGVSg | CHROMOSOME_II:g.519315G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | T27A1 | ||||
Flanking_sequences | cctagatgtagtcccagtggactccaaaag | taactttttcccttcaaaactttttttcta | ||||||
Mapping_target | T27A1 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00050590 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004574 | |||||||
WBStrain00047150 | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003106 | ||||||
Transcript | T27A1.6.1 | VEP_consequence | splice_donor_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | T27A1.6.1:c.407+1G>A | |||||||
Intron_number | 5/10 | |||||||
Interactor | WBInteraction000586280 | |||||||
Genetics | Interpolated_map_position | II | -15.5963 | |||||
Description | Phenotype | WBPhenotype:0000070 | Paper_evidence | WBPaper00031616 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The male tail morphogenesis was grossly abnormal. | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | |||||||
EQ_annotations (3) | ||||||||
Phenotype_assay | Genotype | him-8(e1489) | Paper_evidence | WBPaper00031616 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000134 | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Only very weak expression of unc-129GFP was observed in neurons at the anterior and posterior and very few commissures could be observed exiting the ventral cord in mab-9 mutants. | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | |||||||
EQ_annotations (2) | ||||||||
Phenotype_assay | Genotype | evIs82b [unc-129::GFP] | Paper_evidence | WBPaper00031616 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00031616 | ||||||
WBPaper00037678 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
WBPerson557 | ||||||||
Remark | Animals exhibited defects in axon guidance of dorsally-directed commissures. Defective axons stalled at specific points along their path and then extended laterally to cross a number of commissures. | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | |||||||
mab-9(e2410) animals display axon guidance defects. VD motor neurons extend circumferential commissures that are sometimes misguided. Misguided commissures often stall before reaching the dorsal side and then cross adjacent commissures. | Paper_evidence | WBPaper00037678 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | |||||||
EQ_annotations (3) | ||||||||
Phenotype_assay | Genotype | unc-25::GFP or unc-53::GFP or unc-129::GFP | Paper_evidence | WBPaper00031616 | ||||
Curator_confirmed | WBPerson712 | |||||||
unc-25::gfp | Paper_evidence | WBPaper00037678 | ||||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000432 | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | No spicules were evident. | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | |||||||
EQ_annotations (2) | ||||||||
Phenotype_assay | Genotype | him-8(e1489) | Paper_evidence | WBPaper00031616 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001005 | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals were slightly backwards Unc. | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001672 | Paper_evidence | WBPaper00031616 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | On average 1.5 expressing commisures were misguided per animal, as observed by unc-25::GFP expression. In addition, 100% of animals had at least 1 misguided axon, as observed by unc-53::GFP expression. Whereas, no defects were observed in wild-type animals expressing either GFP construct. | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | |||||||
EQ_annotations (3) | ||||||||
Phenotype_assay | Genotype | unc-25::GFP or unc-53::GFP or unc-129::GFP | Paper_evidence | WBPaper00031616 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0001140 | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals did not show any defects in neuronal cell body positioning. | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00031616 | |||||
Curator_confirmed | WBPerson712 | |||||||
EQ_annotations (2) | ||||||||
Phenotype_assay | Genotype | unc-25::GFP or unc-53::GFP or unc-129::GFP | Paper_evidence | WBPaper00031616 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00031616 | |||||||
WBPaper00050590 | ||||||||
WBPaper00037678 | ||||||||
Method | Substitution_allele |