WormBase Tree Display for Variation: WBVar00144752
expand all nodes | collapse all nodes | view schema
| WBVar00144752 | Evidence | Paper_evidence | WBPaper00029148 | |||||
|---|---|---|---|---|---|---|---|---|
| Name | Public_name | e2333 | ||||||
| Other_name | CE16260:p.Trp593Ter | |||||||
| LLC1.1a.1:c.1778delinsA | ||||||||
| HGVSg | CHROMOSOME_IV:g.14436848delinsT | |||||||
| Sequence_details | SMap | S_parent | Sequence | LLC1 | ||||
| Flanking_sequences | aaaatcgtcagcaatacaaaatcgaagtgt | gaagatcgtaaaatggctcgagaccacct | ||||||
| Mapping_target | LLC1 | |||||||
| Type_of_mutation | Substitution | gg | rr | Paper_evidence | WBPaper00029148 | |||
| SeqStatus | Sequenced | |||||||
| Variation_type | Allele | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Strain | WBStrain00004559 | |||||||
| WBStrain00040924 | ||||||||
| Laboratory | CB | |||||||
| Status | Live | |||||||
| Affects | Gene | WBGene00006606 | ||||||
| Transcript | LLC1.1a.1 | VEP_consequence | stop_gained | |||||
| VEP_impact | HIGH | |||||||
| HGVSc | LLC1.1a.1:c.1778delinsA | |||||||
| HGVSp | CE16260:p.Trp593Ter | |||||||
| cDNA_position | 1812-1813 | |||||||
| CDS_position | 1778-1779 | |||||||
| Protein_position | 593 | |||||||
| Exon_number | 9/10 | |||||||
| Codon_change | tGG/tAG | |||||||
| Amino_acid_change | W/* | |||||||
| Genetics | Interpolated_map_position | IV | 11.9592 | |||||
| Description | Phenotype | WBPhenotype:0000673 | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | brood size increased | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | |||||||
| Phenotype_not_observed | WBPhenotype:0001025 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | XX anatomically WT | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | |||||||
| Reference | WBPaper00013706 | |||||||
| Remark | e2333 is either a W(593) to Amber or W(593) to Ochre | Paper_evidence | WBPaper00029148 | |||||
| Person_evidence | WBPerson1742 | |||||||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006606 Nonsense | ||||||||
| Method | Substitution_allele |
