WormBase Tree Display for Variation: WBVar00144729

WBVar00144729 Evidence: Paper_evidence: WBPaper00003757
  Name: Public_name: e2309
    Other_name: CE01560:p.Trp98Ter
      F26C11.2.1:c.293delinsA
    HGVSg: CHROMOSOME_II:g.9899422delinsT
  Sequence_details: SMap: S_parent: Sequence: F26C11
    Flanking_sequences: tgaatcactaaaaaatcaaattttcaggtt caactggaagagctcgaatcagcattcgaa
    Mapping_target: F26C11
    Type_of_mutation: Substitution: gg rr
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00004549
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00006744
    Transcript: F26C11.2.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: F26C11.2.1:c.293delinsA
        HGVSp: CE01560:p.Trp98Ter
        cDNA_position: 412-413
        CDS_position: 293-294
        Protein_position: 98
        Exon_number: 4/8
        Codon_change: tGG/tAG
        Amino_acid_change: W/*
  Genetics: Interpolated_map_position: II 1.77028
  Description: Phenotype: WBPhenotype:0002514 Paper_evidence: WBPaper00001502
        Curator_confirmed: WBPerson48777
  Reference: WBPaper00003757
    WBPaper00001502
    WBPaper00061175
  Remark: Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006744 Amber_UAG_or_Opal_UGA W(98) to stop Paper_evidence: WBPaper00003757
    Variation stub/paper connection generated from the May 2021 NN VFP dataset.
    Created by WBPerson51134 from the NN_VFP_triage_pipeline
  Method: Substitution_allele