WormBase Tree Display for Variation: WBVar00144583
expand all nodes | collapse all nodes | view schema
WBVar00144583 | Evidence | Paper_evidence | WBPaper00033464 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e2123 | |||||||
Other_name | CE34124:p.Cys131Tyr | ||||||||
Y48A6C.5a.1:c.506G>A | |||||||||
CE22115:p.Cys169Tyr | |||||||||
Y48A6C.5b.1:c.392G>A | |||||||||
HGVSg | CHROMOSOME_III:g.11132968G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y48A6C | |||||
Flanking_sequences | aaatacgaatcgaagactcaaaaagagtat | ctgtatgattaccgatgttcatcaagttat | |||||||
Mapping_target | Y48A6C | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00033464 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (561) | |||||||||
Laboratory | CB | ||||||||
OH | |||||||||
ZAS | |||||||||
Status | Live | ||||||||
Affects (3) | |||||||||
Genetics | Interpolated_map_position | III | 6.13643 | ||||||
Mapping_data | In_multi_point | 1248 | |||||||
In_pos_neg_data | 5729 | ||||||||
5738 | |||||||||
5949 | |||||||||
Description | Phenotype | WBPhenotype:0000050 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | at 25C zygotic embryonic lethal | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000062 | Paper_evidence | WBPaper00032000 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals grow at 15C but not 25C. | Paper_evidence | WBPaper00032000 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000707 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | pharynx fails to undergo late differentiation and morphogenesis; early pharynx development normal | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000843 | Paper_evidence | WBPaper00032000 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mating efficiency is reduced compared to wild type animals. | Paper_evidence | WBPaper00032000 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00032000 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (12) | |||||||||
Method | Substitution_allele |