WormBase Tree Display for Variation: WBVar00144515
expand all nodes | collapse all nodes | view schema
| WBVar00144515 | Evidence | Paper_evidence | WBPaper00001824 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | e2046 | |||||||
| Other_name | C15F1.3a.1:c.*89_*120del | ||||||||
| HGVSg | CHROMOSOME_II:g.6955499_6955530del | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F22D3 | |||||
| Flanking_sequences | TTTCTATTATTTGTACAATTTCCATTTCAT | TATTTAATTTCTTATCTACTCATATCTAAT | |||||||
| Mapping_target | F22D3 | ||||||||
| Type_of_mutation | Deletion | ||||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00004521 | ||||||||
| WBStrain00004533 | |||||||||
| WBStrain00004619 | |||||||||
| Laboratory | CB | ||||||||
| JK | |||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00006605 | |||||||
| Transcript | C15F1.3a.1 | VEP_consequence | 3_prime_UTR_variant | ||||||
| VEP_impact | MODIFIER | ||||||||
| HGVSc | C15F1.3a.1:c.*89_*120del | ||||||||
| cDNA_position | 4517-4548 | ||||||||
| Exon_number | 24/24 | ||||||||
| Interactor | WBInteraction000052163 | ||||||||
| Genetics | Interpolated_map_position | II | 0.150004 | ||||||
| Description | Phenotype | WBPhenotype:0000682 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | weaker than e2020 | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Variation_effect | Hypermorph_gain_of_function | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001022 | Paper_evidence | WBPaper00000922 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Complete feminization of XX animals (both e2046/+ and e2046/e2046). e2046 has no effect on XO animals | Paper_evidence | WBPaper00000922 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Dominant | Paper_evidence | WBPaper00000922 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00000922 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000922 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference | WBPaper00014925 | ||||||||
| WBPaper00000922 | |||||||||
| WBPaper00001037 | |||||||||
| WBPaper00001824 | |||||||||
| Remark | e2046, q122, and q244 all carry the same molecular change but were produced by different labs independently. WormBase has a policy to merge identical naturally occurring polymorphisms in wild isolates, but maintain separate records for mutants. | ||||||||
| Method | Deletion_allele |
