WormBase Tree Display for Variation: WBVar00144489
expand all nodes | collapse all nodes | view schema
WBVar00144489 | Evidence | Paper_evidence | WBPaper00001824 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e2020 | |||||||
Other_name | C15F1.3a.1:c.*59_*166del | ||||||||
HGVSg | CHROMOSOME_II:g.6955453_6955560del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F22D3 | |||||
Flanking_sequences | TTCCAAAATTTCATTTCTTACTCATTTTCG | ACTTGTAATCTTTACGAATTTTGTTTTCTT | |||||||
Mapping_target | F22D3 | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004506 | ||||||||
WBStrain00004628 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006605 | |||||||
Transcript | C15F1.3a.1 | VEP_consequence | 3_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | C15F1.3a.1:c.*59_*166del | ||||||||
cDNA_position | 4487-4594 | ||||||||
Exon_number | 24/24 | ||||||||
Interactor | WBInteraction000576797 | ||||||||
Genetics | Interpolated_map_position | II | 0.149994 | ||||||
Description | Phenotype | WBPhenotype:0000424 | Paper_evidence | WBPaper00028730 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | the intestinal nuclei of rpn-10; ufd-2 (RNAi)-treated worms as well as gain-of-function mutant tra-2 (e2020) were stained more strongly than those of wild-type worms (vector RNAi control) | Paper_evidence | WBPaper00028730 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Gain_of_function_undetermined_type | Paper_evidence | WBPaper00028730 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005792 | PATO:0000460 | Paper_evidence | WBPaper00028730 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00028730 | |||||
Curator_confirmed | WBPerson712 | ||||||||
GO_term | GO:0005634 | PATO:0000460 | Paper_evidence | WBPaper00028730 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000682 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | XX animals completely feminized, XO animals fertile males, slightly feminized; e2020/+ XX also female | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Dominant | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00028730 | ||||||||
WBPaper00016482 | |||||||||
WBPaper00015242 | |||||||||
WBPaper00016310 | |||||||||
WBPaper00020776 | |||||||||
Method | Deletion_allele |