WormBase Tree Display for Variation: WBVar00144478
expand all nodes | collapse all nodes | view schema
| WBVar00144478 | Evidence | Paper_evidence | WBPaper00002121 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | e2009 | |||||||
| Other_name | CE52664:p.Pro80Ser | ||||||||
| CE52672:p.Pro80Ser | |||||||||
| Y47D3A.6a.1:c.238C>T | |||||||||
| Y47D3A.6b.1:c.238C>T | |||||||||
| HGVSg | CHROMOSOME_III:g.11191872G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | Y47D3A | |||||
| Flanking_sequences | acaagtaatttcattcaaagctcagttccc | cgtcacatcaaactttgagcaatcctctgc | |||||||
| Mapping_target | Y47D3A | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002121 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00006604 | |||||||
| WBGene00305760 | |||||||||
| Transcript | Y48A6C.12 | ||||||||
| Y47D3A.6b.1 | VEP_consequence | missense_variant | |||||||
| VEP_impact | MODERATE | ||||||||
| HGVSc | Y47D3A.6b.1:c.238C>T | ||||||||
| HGVSp | CE52664:p.Pro80Ser | ||||||||
| cDNA_position | 376 | ||||||||
| CDS_position | 238 | ||||||||
| Protein_position | 80 | ||||||||
| Exon_number | 5/10 | ||||||||
| Codon_change | Ccg/Tcg | ||||||||
| Amino_acid_change | P/S | ||||||||
| Y47D3A.6a.1 | VEP_consequence | missense_variant | |||||||
| VEP_impact | MODERATE | ||||||||
| HGVSc | Y47D3A.6a.1:c.238C>T | ||||||||
| HGVSp | CE52672:p.Pro80Ser | ||||||||
| cDNA_position | 376 | ||||||||
| CDS_position | 238 | ||||||||
| Protein_position | 80 | ||||||||
| Exon_number | 5/20 | ||||||||
| Codon_change | Ccg/Tcg | ||||||||
| Amino_acid_change | P/S | ||||||||
| Genetics | Interpolated_map_position | III | 6.94324 | ||||||
| Description | Phenotype | WBPhenotype:0000687 | Paper_evidence | WBPaper00000922 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | tra-1/+ XX animals are usually fertile females and tra-l/+ XO animals are females or intersexes. Homozygous XX and XO animals are completely feminized. | Paper_evidence | WBPaper00000922 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Dominant | Paper_evidence | WBPaper00000922 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000922 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference | WBPaper00000922 | ||||||||
| Method | Substitution_allele |
