WormBase Tree Display for Variation: WBVar00144428
expand all nodes | collapse all nodes | view schema
| WBVar00144428 | Evidence | Paper_evidence | WBPaper00005045 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | e1959 | |||||
| Other_name | Y54E10A.4a.1:c.-32C>T | ||||||
| Y54E10A.4b.1:c.611C>T | |||||||
| Y54E10A.4a.2:c.-32C>T | |||||||
| CE27480:p.Ser204Phe | |||||||
| HGVSg | CHROMOSOME_I:g.3213086C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | Y54E10A | |||
| Flanking_sequences | atcggaacgagaacaatcaacgagtcgtct | caacaaagtattcgttggtggaatctcgca | |||||
| Mapping_target | Y54E10A | ||||||
| Type_of_mutation | Substitution | c | t | ||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | CB | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00001481 | |||||
| Transcript | Y54E10A.4a.1 | VEP_consequence | 5_prime_UTR_variant | ||||
| VEP_impact | MODIFIER | ||||||
| HGVSc | Y54E10A.4a.1:c.-32C>T | ||||||
| cDNA_position | 623 | ||||||
| Exon_number | 5/11 | ||||||
| Y54E10A.4b.1 | VEP_consequence | missense_variant | |||||
| VEP_impact | MODERATE | ||||||
| HGVSc | Y54E10A.4b.1:c.611C>T | ||||||
| HGVSp | CE27480:p.Ser204Phe | ||||||
| cDNA_position | 623 | ||||||
| CDS_position | 611 | ||||||
| Protein_position | 204 | ||||||
| Exon_number | 6/10 | ||||||
| Codon_change | tCc/tTc | ||||||
| Amino_acid_change | S/F | ||||||
| Y54E10A.4a.2 | VEP_consequence | 5_prime_UTR_variant | |||||
| VEP_impact | MODIFIER | ||||||
| HGVSc | Y54E10A.4a.2:c.-32C>T | ||||||
| cDNA_position | 97 | ||||||
| Exon_number | 1/7 | ||||||
| Isolation | Mutagen | EMS | |||||
| Genetics | Interpolated_map_position | I | -4.47298 | ||||
| Mapping_data | In_2_point | 2502 | |||||
| In_multi_point | 976 | ||||||
| 977 | |||||||
| 978 | |||||||
| Description | Phenotype | WBPhenotype:0000687 | Person_evidence | WBPerson261 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | homozygous XX animals transformed into fertile females; homozygous XO animals are somatically male, make oocytes in germ line; heterozygous XO animals are somatically male with both sperm and oocytes in germline. | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Ease_of_scoring | ES2_Difficult_to_score | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00016427 | ||||||
| WBPaper00016310 | |||||||
| Method | Substitution_allele |
