WormBase Tree Display for Variation: WBVar00144371
expand all nodes | collapse all nodes | view schema
WBVar00144371 | Evidence | Person_evidence | WBPerson260 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e1865 | |||||
Other_name (18) | |||||||
HGVSg | CHROMOSOME_III:g.7735874C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | ZK112 | |||
Flanking_sequences | atcattttcgatatgttcggcaacatcttg | aaaagttctcatgctctcgctatctcgagt | |||||
Mapping_target | ZK112 | ||||||
Type_of_mutation | Substitution | c | t | Person_evidence | WBPerson260 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (74) | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00003559 | |||||
Transcript | ZK112.2g.3 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | ZK112.2g.3:c.2134C>T | ||||||
HGVSp | CE00373:p.Gln712Ter | ||||||
cDNA_position | 2268 | ||||||
CDS_position | 2134 | ||||||
Protein_position | 712 | ||||||
Exon_number | 9/11 | ||||||
Codon_change | Caa/Taa | ||||||
Amino_acid_change | Q/* | ||||||
ZK112.2f.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK112.2f.1:c.2320C>T | ||||||
HGVSp | CE50296:p.Gln774Ter | ||||||
cDNA_position | 2320 | ||||||
CDS_position | 2320 | ||||||
Protein_position | 774 | ||||||
Exon_number | 9/10 | ||||||
Codon_change | Caa/Taa | ||||||
Amino_acid_change | Q/* | ||||||
ZK112.2h.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK112.2h.1:c.2143C>T | ||||||
HGVSp | CE50238:p.Gln715Ter | ||||||
cDNA_position | 2143 | ||||||
CDS_position | 2143 | ||||||
Protein_position | 715 | ||||||
Exon_number | 8/9 | ||||||
Codon_change | Caa/Taa | ||||||
Amino_acid_change | Q/* | ||||||
ZK112.2d.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK112.2d.1:c.2482C>T | ||||||
HGVSp | CE50175:p.Gln828Ter | ||||||
cDNA_position | 2482 | ||||||
CDS_position | 2482 | ||||||
Protein_position | 828 | ||||||
Exon_number | 10/11 | ||||||
Codon_change | Caa/Taa | ||||||
Amino_acid_change | Q/* | ||||||
ZK112.2g.2 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK112.2g.2:c.2134C>T | ||||||
HGVSp | CE00373:p.Gln712Ter | ||||||
cDNA_position | 2499 | ||||||
CDS_position | 2134 | ||||||
Protein_position | 712 | ||||||
Exon_number | 11/13 | ||||||
Codon_change | Caa/Taa | ||||||
Amino_acid_change | Q/* | ||||||
ZK112.2e.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK112.2e.1:c.2329C>T | ||||||
HGVSp | CE50121:p.Gln777Ter | ||||||
cDNA_position | 2329 | ||||||
CDS_position | 2329 | ||||||
Protein_position | 777 | ||||||
Exon_number | 9/10 | ||||||
Codon_change | Caa/Taa | ||||||
Amino_acid_change | Q/* | ||||||
ZK112.2g.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK112.2g.1:c.2134C>T | ||||||
HGVSp | CE00373:p.Gln712Ter | ||||||
cDNA_position | 2365 | ||||||
CDS_position | 2134 | ||||||
Protein_position | 712 | ||||||
Exon_number | 10/12 | ||||||
Codon_change | Caa/Taa | ||||||
Amino_acid_change | Q/* | ||||||
ZK112.2c.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK112.2c.1:c.2491C>T | ||||||
HGVSp | CE50320:p.Gln831Ter | ||||||
cDNA_position | 2491 | ||||||
CDS_position | 2491 | ||||||
Protein_position | 831 | ||||||
Exon_number | 10/11 | ||||||
Codon_change | Caa/Taa | ||||||
Amino_acid_change | Q/* | ||||||
ZK112.2a.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK112.2a.1:c.2518C>T | ||||||
HGVSp | CE50144:p.Gln840Ter | ||||||
cDNA_position | 2580 | ||||||
CDS_position | 2518 | ||||||
Protein_position | 840 | ||||||
Exon_number | 12/14 | ||||||
Codon_change | Caa/Taa | ||||||
Amino_acid_change | Q/* | ||||||
ZK112.2b.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK112.2b.1:c.2527C>T | ||||||
HGVSp | CE50327:p.Gln843Ter | ||||||
cDNA_position | 2527 | ||||||
CDS_position | 2527 | ||||||
Protein_position | 843 | ||||||
Exon_number | 11/13 | ||||||
Codon_change | Caa/Taa | ||||||
Amino_acid_change | Q/* | ||||||
Interactor | WBInteraction000518814 | ||||||
Genetics | Interpolated_map_position | III | -0.626159 | ||||
Mapping_data | In_2_point | 670 | |||||
In_multi_point (11) | |||||||
Description | Phenotype | WBPhenotype:0000463 | Paper_evidence | WBPaper00049471 | |||
Curator_confirmed | WBPerson664 | ||||||
WBPhenotype:0000722 | Paper_evidence | WBPaper00041268 | |||||
Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||
WBPerson18350 | |||||||
Remark | abnormal large nucleoli in all cells | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Figure 5, enlarged nucleoli | Paper_evidence | WBPaper00041268 | |||||
Curator_confirmed | WBPerson18350 | ||||||
Figure 5, abnormal presence of nucleoli at the 4-cell stage | Paper_evidence | WBPaper00041268 | |||||
Curator_confirmed | WBPerson18350 | ||||||
Ease_of_scoring | ES1_Very_hard_to_score | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Phenotype_not_observed | WBPhenotype:0000113 | Paper_evidence | WBPaper00032132 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals have similar levels of rRNA to wild-type as determined from L1-staged animals. | Paper_evidence | WBPaper00032132 | ||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032132 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00015384 | ||||||
WBPaper00041268 | |||||||
WBPaper00027285 | |||||||
WBPaper00015484 | |||||||
WBPaper00022309 | |||||||
WBPaper00032132 | |||||||
WBPaper00021732 | |||||||
WBPaper00015397 | |||||||
WBPaper00016409 | |||||||
WBPaper00015352 | |||||||
WBPaper00016338 | |||||||
WBPaper00016124 | |||||||
WBPaper00016591 | |||||||
WBPaper00049471 | |||||||
WBPaper00065313 | |||||||
WBPaper00065813 | |||||||
Method | Substitution_allele |