WormBase Tree Display for Variation: WBVar00144325
expand all nodes | collapse all nodes | view schema
WBVar00144325 | Evidence | Paper_evidence | WBPaper00004503 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1814 | |||||||
Other_name | CE20264:p.Gln686Ter | ||||||||
CE30361:p.Gln686Ter | |||||||||
Y47H9C.4b.1:c.2056C>T | |||||||||
Y47H9C.4a.1:c.2056C>T | |||||||||
Y47H9C.4c.1:c.2056C>T | |||||||||
CE30362:p.Gln686Ter | |||||||||
HGVSg | CHROMOSOME_I:g.11859998G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y47H9C | |||||
Flanking_sequences | tgtcccgctgggagctatggcgatggctgt | agcaagtgtgctcctgtgccgacggtcatg | |||||||
Mapping_target | Y47H9C | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00004503 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000415 | |||||||
Transcript | Y47H9C.4a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y47H9C.4a.1:c.2056C>T | ||||||||
HGVSp | CE20264:p.Gln686Ter | ||||||||
cDNA_position | 2062 | ||||||||
CDS_position | 2056 | ||||||||
Protein_position | 686 | ||||||||
Exon_number | 7/13 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
Y47H9C.4c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y47H9C.4c.1:c.2056C>T | ||||||||
HGVSp | CE30362:p.Gln686Ter | ||||||||
cDNA_position | 2062 | ||||||||
CDS_position | 2056 | ||||||||
Protein_position | 686 | ||||||||
Exon_number | 7/12 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
Y47H9C.4b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y47H9C.4b.1:c.2056C>T | ||||||||
HGVSp | CE30361:p.Gln686Ter | ||||||||
cDNA_position | 2062 | ||||||||
CDS_position | 2056 | ||||||||
Protein_position | 686 | ||||||||
Exon_number | 7/13 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
Genetics | Interpolated_map_position | I | 12.8803 | ||||||
Description | Phenotype | WBPhenotype:0000241 | Paper_evidence | WBPaper00004503 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Cell corpses persisted in the L1 head. No cell corpses were observed in the wild-type L1 head. | Paper_evidence | WBPaper00004503 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00004503 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00004503 | ||||||||
Method | Substitution_allele |