WormBase Tree Display for Variation: WBVar00144321
expand all nodes | collapse all nodes | view schema
| WBVar00144321 | Name | Public_name | e1810 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Other_name | CE42072:p.Gln856Ter | ||||||||
| C27A7.4.1:c.2566C>T | |||||||||
| HGVSg | CHROMOSOME_V:g.12146313G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C27A7 | |||||
| Flanking_sequences | tatgatttgatgaacaagctttatcagtct | aaaatatgtggtcatcagcttttgaaattg | |||||||
| Mapping_target | C27A7 | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00006516 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00004476 | ||||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00000490 | |||||||
| Transcript | C27A7.4.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | C27A7.4.1:c.2566C>T | ||||||||
| HGVSp | CE42072:p.Gln856Ter | ||||||||
| cDNA_position | 2584 | ||||||||
| CDS_position | 2566 | ||||||||
| Protein_position | 856 | ||||||||
| Exon_number | 15/22 | ||||||||
| Codon_change | Caa/Taa | ||||||||
| Amino_acid_change | Q/* | ||||||||
| Interactor | WBInteraction000502138 | ||||||||
| WBInteraction000502659 | |||||||||
| WBInteraction000520980 | |||||||||
| Genetics | Interpolated_map_position | V | 3.67455 | ||||||
| Mapping_data | In_2_point | 790 | |||||||
| In_multi_point | 722 | ||||||||
| 1172 | |||||||||
| 1807 | |||||||||
| 3067 | |||||||||
| 3068 | |||||||||
| 3069 | |||||||||
| 3070 | |||||||||
| 3072 | |||||||||
| In_pos_neg_data | 8320 | ||||||||
| Description | Phenotype (12) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000315 | Paper_evidence | WBPaper00000932 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000478 | Paper_evidence | WBPaper00000932 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001660 | Paper_evidence | WBPaper00006052 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | No disruption of ASE asymmetry (as seen with lim-6 reporters) | Paper_evidence | WBPaper00006052 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00006052 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Genotype | otIs114, otIs6 | Paper_evidence | WBPaper00006052 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001780 | Paper_evidence | WBPaper00029060 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Mutants show normal butanone enhancement | Paper_evidence | WBPaper00029060 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00029060 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Preexposure to 1:10 dilution of butanone and food. Animals were then subjected to odorant chemotaxis assays and/or selection assays | Paper_evidence | WBPaper00029060 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference (12) | |||||||||
| Method | Substitution_allele |
