WormBase Tree Display for Variation: WBVar00144310
expand all nodes | collapse all nodes | view schema
| WBVar00144310 | Evidence | Paper_evidence | WBPaper00004503 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | e1798 | |||||||
| Other_name | CE30362:p.Gln887Ter | ||||||||
| CE20264:p.Gln887Ter | |||||||||
| Y47H9C.4c.1:c.2659C>T | |||||||||
| Y47H9C.4a.1:c.2659C>T | |||||||||
| Y47H9C.4b.1:c.2659C>T | |||||||||
| CE30361:p.Gln887Ter | |||||||||
| HGVSg | CHROMOSOME_I:g.11857218G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | Y47H9C | |||||
| Flanking_sequences | gatgctgcaattggctgctgccatgtagat | aaatgtcctgcggaaaagcgaaacaagaat | |||||||
| Mapping_target | Y47H9C | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00004503 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00000415 | |||||||
| Transcript | Y47H9C.4a.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | Y47H9C.4a.1:c.2659C>T | ||||||||
| HGVSp | CE20264:p.Gln887Ter | ||||||||
| cDNA_position | 2665 | ||||||||
| CDS_position | 2659 | ||||||||
| Protein_position | 887 | ||||||||
| Exon_number | 9/13 | ||||||||
| Codon_change | Caa/Taa | ||||||||
| Amino_acid_change | Q/* | ||||||||
| Y47H9C.4c.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | Y47H9C.4c.1:c.2659C>T | ||||||||
| HGVSp | CE30362:p.Gln887Ter | ||||||||
| cDNA_position | 2665 | ||||||||
| CDS_position | 2659 | ||||||||
| Protein_position | 887 | ||||||||
| Exon_number | 9/12 | ||||||||
| Codon_change | Caa/Taa | ||||||||
| Amino_acid_change | Q/* | ||||||||
| Y47H9C.4b.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | Y47H9C.4b.1:c.2659C>T | ||||||||
| HGVSp | CE30361:p.Gln887Ter | ||||||||
| cDNA_position | 2665 | ||||||||
| CDS_position | 2659 | ||||||||
| Protein_position | 887 | ||||||||
| Exon_number | 9/13 | ||||||||
| Codon_change | Caa/Taa | ||||||||
| Amino_acid_change | Q/* | ||||||||
| Genetics | Interpolated_map_position | I | 12.6289 | ||||||
| Description | Phenotype | WBPhenotype:0000241 | Paper_evidence | WBPaper00004503 | |||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Cell corpses persisted in the L1 head. No cell corpses were observed in the wild-type L1 head. | Paper_evidence | WBPaper00004503 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00004503 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference | WBPaper00004503 | ||||||||
| Method | Substitution_allele |
