WormBase Tree Display for Variation: WBVar00144287
expand all nodes | collapse all nodes | view schema
WBVar00144287 | Evidence | Paper_evidence | WBPaper00002345 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1763 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_X | |||||
Flanking_sequences | gaacactatctcctctccattgtctatttt | ttttcactcccggcgatttgccgatttgct | |||||||
Mapping_target | CHROMOSOME_X | ||||||||
Type_of_mutation | Deletion | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00030840 | ||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00023498 | |||||||
WBGene00023497 | |||||||||
Transcript | ZK678.1.1 | ||||||||
ZK662.4.1 | |||||||||
ZK662.4.2 | |||||||||
Interactor | WBInteraction000000671 | ||||||||
WBInteraction000500666 | |||||||||
WBInteraction000500676 | |||||||||
WBInteraction000504229 | |||||||||
WBInteraction000505213 | |||||||||
WBInteraction000524137 | |||||||||
WBInteraction000524143 | |||||||||
WBInteraction000524144 | |||||||||
Genetics | Interpolated_map_position | X | 22.9456 | ||||||
Description | Phenotype | WBPhenotype:0000216 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Remark | defect in Bδ cell fate specification | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0008451 | PATO:0000460 | Paper_evidence | WBPaper00035553 | ||||
Curator_confirmed | WBPerson625 | ||||||||
GO_term | GO:0001708 | PATO:0000460 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Phenotype_assay | Control_strain | WBStrain00044748 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Treatment | ceh-13::gfp as marker of Bγ cell fate syIs145 PS4807 contains the ceh-13::GFP integrated transgene syIs145 that was obtained by microinjection of pMF1 at 10 ng/μl, pBS at 20 ng/μl and unc-119(+) at 40 ng/μl into unc-119(ed4); him-5(e1490) mutant animals. | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
Genotype | sIys145 [ceh-13::GFP] | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
WBPhenotype:0000414 | Paper_evidence | WBPaper00003135 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | lin-15(e1763) resulted in a 54% penetrant P11 to P12 cell fate transformation (Table 1A) | Paper_evidence | WBPaper00003135 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 54% penetrance | Paper_evidence | WBPaper00003135 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00003135 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004410 | PATO:0000460 | Paper_evidence | WBPaper00003135 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004409 | PATO:0000460 | Paper_evidence | WBPaper00003135 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000425 | Paper_evidence | WBPaper00037906 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | LIN-15A nuclear staining is greatly reduced in these mutants. | Paper_evidence | WBPaper00037906 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000700 | Paper_evidence | WBPaper00000762 | |||||||
WBPaper00037906 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | 2 or 3 large ventral protrusions | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
This phenotype is not rescued by overexpression of lin-56. | Paper_evidence | WBPaper00037906 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000762 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | him-5(e1467) | Paper_evidence | WBPaper00000762 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001276 | Paper_evidence | WBPaper00035553 | |||||||
Curator_confirmed | WBPerson625 | ||||||||
Remark | syIs45 expressed in Bδ (abnormal spicule development) | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0008451 | PATO:0000460 | Paper_evidence | WBPaper00035553 | ||||
Curator_confirmed | WBPerson625 | ||||||||
GO_term | GO:0010467 | PATO:0000460 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Phenotype_assay | Control_strain | WBStrain00044748 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Treatment | ceh-13::gfp as marker of Bγ cell fate syIs145 PS4807 contains the ceh-13::GFP integrated transgene syIs145 that was obtained by microinjection of pMF1 at 10 ng/μl, pBS at 20 ng/μl and unc-119(+) at 40 ng/μl into unc-119(ed4); him-5(e1490) mutant animals. | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
Genotype | sIys145 [ceh-13::GFP] | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
WBPhenotype:0001487 | Paper_evidence | WBPaper00035553 | |||||||
Curator_confirmed | WBPerson625 | ||||||||
Remark | syIs45 expressed in Bδ (abnormal spicule development) | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0008451 | PATO:0000460 | Paper_evidence | WBPaper00035553 | ||||
Curator_confirmed | WBPerson625 | ||||||||
GO_term | GO:0048608 | PATO:0000460 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Phenotype_assay | Control_strain | WBStrain00044748 | Paper_evidence | WBPaper00035553 | |||||
Curator_confirmed | WBPerson625 | ||||||||
Treatment | ceh-13::gfp as marker of Bγ cell fate syIs145 PS4807 contains the ceh-13::GFP integrated transgene syIs145 that was obtained by microinjection of pMF1 at 10 ng/μl, pBS at 20 ng/μl and unc-119(+) at 40 ng/μl into unc-119(ed4); him-5(e1490) mutant animals. | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
Genotype | sIys145 [ceh-13::GFP] | Paper_evidence | WBPaper00035553 | ||||||
Curator_confirmed | WBPerson625 | ||||||||
Phenotype_not_observed | WBPhenotype:0000134 | Paper_evidence | WBPaper00037906 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | LIN-15A RNA levels are not reduced in these mutants compared to wild type, as measured through RT-PCR. | Paper_evidence | WBPaper00037906 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00004481 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In a lin-15 loss-of-function background, all VPCs often adopt vulval fates, and P6.p is always the closest VPC to the AC and adopts the 1° fate. We observed wild-type zmp-1::GFP expression in 39 of 41 P6.p lineages (Table 5; the remaining two animals had an abnormal gonad). Therefore, lin-15 is not required for normal 1° patterning. Furthermore, unlike let-23(gf), the lin-15(lf) mutation does not suppress the 1° patterning defect caused by the absence of the AC. When the AC was ablated at the late P6.px stage or the early P6.pxx stage, the expression patterns of zmp-1::GFP in P6.pxxx cells were disturbed in 17 of 19 animals examined (P<0.0001, Table 5). Thus, lin-15 is likely not involved in negatively regulating RAS signaling during 1° lineage patterning." | Paper_evidence | WBPaper00004481 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007809 | PATO:0000460 | Paper_evidence | WBPaper00004481 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | syIs49 [zmp-1::GFP] | Paper_evidence | WBPaper00004481 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference (11) | |||||||||
Method | Deletion_allele |