WormBase Tree Display for Variation: WBVar00144284
expand all nodes | collapse all nodes | view schema
WBVar00144284 | Evidence | Paper_evidence | WBPaper00002473 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1756 | |||||||
Other_name | CE29089:p.Gln271Ter | ||||||||
D2045.6.1:c.811C>T | |||||||||
HGVSg | CHROMOSOME_III:g.10472102C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | D2045 | |||||
Flanking_sequences | tacatgattaaagtggagacaagacttaat | aagaggatgatcgctgtcaactctacctga | |||||||
Mapping_target | D2045 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002473 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00028849 | ||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000836 | |||||||
Transcript | D2045.6.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | D2045.6.1:c.811C>T | ||||||||
HGVSp | CE29089:p.Gln271Ter | ||||||||
cDNA_position | 812 | ||||||||
CDS_position | 811 | ||||||||
Protein_position | 271 | ||||||||
Exon_number | 3/8 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Genetics | Interpolated_map_position | III | 2.51832 | ||||||
Mapping_data | In_2_point | 671 | |||||||
In_multi_point | 584 | ||||||||
585 | |||||||||
586 | |||||||||
1245 | |||||||||
2318 | |||||||||
Description | Phenotype | WBPhenotype:0000358 | Paper_evidence | WBPaper00004382 | |||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | cul-1(lf) allele shows a pronounced hyperproliferation of vulval cells | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Normal L1, extra cell divisions in most post-embryonic lineages (about 4-fold increase; extra cells smaller, but differentiate); sterile. Easy to score (ES3) in adult. | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00004382 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000695 | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The morphology of vulval cell nuclei in cul-1 mutants appeared somewhat indistinct relative to wild-type animals. | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00004382 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000699 | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Vulval cells in cul-1 mutants do not initiate ingression until after the third cycle, whereas wild-type vulval cells begin to invaginate following the second division cycle | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00004382 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000746 | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Vulval cell divisions in cul-1 mutants occur in a somewhat less synchronous manner than those generally observed in wild type | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00004382 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000318 | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Vulval cell-cycle lengths are similar to that of wildtype animals (1.75-2.5 hours) | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00004382 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000354 | Paper_evidence | WBPaper00004382 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Despite extra division cycles, vulval cells in cul-1 mutants can execute differentiation programs and acquire their correct terminal fates | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00004382 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00004382 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | mgIs21 [lin-11::GFP], ayIs4 [egl-17::GFP] | Paper_evidence | WBPaper00004382 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001219 | Paper_evidence | WBPaper00032114 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Hermaphrodites do not exhibit any defects in sex-specific CEM apoptosis | Paper_evidence | WBPaper00032114 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | smIs26 [pkd-2p::gfp] | Paper_evidence | WBPaper00032114 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00004382 | ||||||||
WBPaper00032114 | |||||||||
Method | Substitution_allele |