WormBase Tree Display for Variation: WBVar00144283

WBVar00144283 Evidence: Paper_evidence: WBPaper00004503
  Name: Public_name: e1754
    Other_name: CE30361:p.Gln32Ter
      Y47H9C.4c.1:c.94C>T
      CE30362:p.Gln32Ter
      Y47H9C.4b.1:c.94C>T
      CE20264:p.Gln32Ter
      Y47H9C.4a.1:c.94C>T
    HGVSg: CHROMOSOME_I:g.11868006G>A
  Sequence_details: SMap: S_parent: Sequence: Y47H9C
    Flanking_sequences: acatttcccgacaaattaacacagcagctg agcagcaggggacaacagaaccacaaggag
    Mapping_target: Y47H9C
    Type_of_mutation: Substitution: c t Paper_evidence: WBPaper00004503
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00004460
    Laboratory: CB
    Status: Live
  Affects: Gene: WBGene00000415
    Transcript: Y47H9C.4a.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: Y47H9C.4a.1:c.94C>T
        HGVSp: CE20264:p.Gln32Ter
        cDNA_position: 100
        CDS_position: 94
        Protein_position: 32
        Exon_number: 2/13
        Codon_change: Cag/Tag
        Amino_acid_change: Q/*
      Y47H9C.4c.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: Y47H9C.4c.1:c.94C>T
        HGVSp: CE30362:p.Gln32Ter
        cDNA_position: 100
        CDS_position: 94
        Protein_position: 32
        Exon_number: 2/12
        Codon_change: Cag/Tag
        Amino_acid_change: Q/*
      Y47H9C.4b.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: Y47H9C.4b.1:c.94C>T
        HGVSp: CE30361:p.Gln32Ter
        cDNA_position: 100
        CDS_position: 94
        Protein_position: 32
        Exon_number: 2/13
        Codon_change: Cag/Tag
        Amino_acid_change: Q/*
  Genetics: Interpolated_map_position: I 12.8844
  Description: Phenotype: WBPhenotype:0000241 Paper_evidence: WBPaper00004503
        Curator_confirmed: WBPerson712
        Remark: Cell corpses persisted in the L1 head and throughout the body during other stages, including in the posterior ventral cord and tail in larvae and in the germline in adults. No cell corpses were observed in the wild-type L1 head. Paper_evidence: WBPaper00004503
            Curator_confirmed: WBPerson712
        Variation_effect: Null: Paper_evidence: WBPaper00004503
            Curator_confirmed: WBPerson712
        EQ_annotations: Life_stage: WBls:0000024 PATO:0000460 Paper_evidence: WBPaper00004503
                Curator_confirmed: WBPerson712
            WBls:0000035 PATO:0000460 Paper_evidence: WBPaper00004503
                Curator_confirmed: WBPerson712
            WBls:0000041 PATO:0000460 Paper_evidence: WBPaper00004503
                Curator_confirmed: WBPerson712
  Reference: WBPaper00004503
  Method: Substitution_allele